Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1506
Length(NT) : 973
Best Gene Model Blast : Link to GSTUMT00003562001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215253.1| Score: 141 E_value: 5e-07
KEGG Definition: predicted protein
Accession: aor:AO090003000221 Score: 141 E_value: 2e-07
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3794 Score: 108 E_value: 8e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1506
TTGGATCATTATCACCCCTTTCTGTTGACCAGAAACATACATATACATCA
AGCGCAGAATCCATTGTTCAATTCTTCATTATCGGTAACGAGAGTCCCAT
AATCCTGGTTTGGATTGAACATTTGTGAAACAACAAAAGAATCTTGCAAT
CCCGTGACCATTGAAATCATGACAACGGAAGGATTGAATATGGCGCTTCA
GGCTGCCTCACATGTCCCTGCTCTGGCTTCTACCATCACGGTGATGGATA
CCAGTGGGAAGGTGGTTAATACGTCCAAGAATATCTTCTCAGCGTTCAAG
GAAGCTCGCACCGCCTACCGCACCCGCAAAGCTGAAATAGCCGAGGAGCG
TGCCCGCCAGAGTGCCCGCCGCGACGAAGCCCGACTGCGCGCCGCCCGAA
AGCATAGCGCATCAGCGGCTCGCCGACTAGAACGATCCAATACCGGCGTA
CTAATGATCGAAGACGACGAGGAGCGACGCCGGCGAAAGAAGGAGAAGAA
GGAGAAAAAGCAGAGATCTTCCTCCTCGTCATCCTCGGGCACCGGCTCGG
ACATTAGCTTCGAAGACAACTCCGGGAGCACTGTTCTCACCACCACAAAC
AATAATCATAGCGTGACGAGGTCGAACAGCAGCGAGACTATGCGGACCGA
AGCGACCTTGTTTACCCCTGGGGGTCTACGCGGAAATATGTCGGTCATTT
CATTGATCCCCGAAATGGTTCTCTCCCAACCGGATCCCATGACGGAGAAT
CTTCAACTCCTCCTCCTGCAGCTACAGGCTACGATCGATGAGCTATCGTG
TTGGTCAGCGGGTATTGCGGCGCTCATTTCCGAGCTGCAGAAGGTTCCGG
ATACCCTCGCAGTTGTCGGTTTCACCCTCGCCGAAATATCCGCTCTTGTA
GCGAAAGTCAGTCCCGCAGCAATCATGGGCTTGAAGACCCTGTTCCCTAT
GATCTTTGCATTACTGGGGAGTC

Sequences in the Contig:

SY0AAA40YF15FM1 SY0AAA53YC05FM1