Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1505
Length(NT) : 863
Best Gene Model Blast : Link to GSTUMT00006450001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_10211
Accession: ref|XP_001551385.1| Score: 954 E_value: 1e-101
KEGG Definition: sexual development transcription factor SteA
Accession: afm:AFUA_5G06190 Score: 944 E_value: 1e-100
KOG Definition: No Hit Found
PFAM Definition: STE, STE like transcription factor..
Pfam Number: pfam02200 Score: 481 E_value: 4e-49
Swissprot: O74252|STE12_EMENI
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0016564 = Molecular function: transcription repressor activity
GO:0000122 = Biological process: negative regulation of transcription from RNA polymerase II promoter
GO:0019953 = Biological process: sexual reproduction

Sequence:
>Contig1505
TTGGATAACCTTTTCCATATCTCGGGTACCGATATCGTAAGATGCTTGTC
GTTTCGCTTCCAGGCGTTTGGCCGACCGGTGAAGAATTCAAAAAAGTTTG
AAGAGGGGATTTTTTCCGACTTGAGAAACTTAAAGTCTGGGACAGACGCG
TCGCTGGAGGAGCCTAAGAGCCCTTTTCTCGACTTTCTTTACAAAAATAA
CTGCATTAGAACCCAGAAGAAGCAGAAGGTATTCTACTGGTATAGTGTTC
CTCATGATCGCCTTTTCCTAGATGCGCTGGAGCGTGATCTCAAGAGGGAA
AAGATGGGACAGGAAGCTACAACGGTTGCTGTTAGCGAACCGGCTCTTTC
ATTCGAATTCGACTCGTCGCAGTCGCTTTTTGAGCAACTCACAAAGGCGC
AGCAGGCGAACTCATCTTCATTTTCTGCTCATGCTTCTTACTCCTCTTCT
ACCTCCCCTGTGATGCGCGCTATGGATTCAATGCCGCCGCCACAGATAAT
ACCCCACTCAATGCCCGTTGTACATGAAGATATGGGCCAGATGGGTTCGT
ATCCTCAGATACCGATGTCCCTTCCGGCTCCGGTGAAAAGGGAAGATGAA
TTTTCGGTAGGACCCTATTATCCGTCAGACAGGACGGGAATGCCGCTATC
GAGGCCGATGCATCAGCGAACAGTGTCAATGCCGAGCTATTTGGAGTATT
CCCCGGCTCCGTCGTTTGCTCCGTCAGAAGATTATAGTGCTCGAGGTATC
TCGTACGAGCCTGTTACTCCCCCCCAGCAGATGGTACAGCTTTCTGAGCC
TCATTATCTTGCCCATGACGGCAATGTGTATAATACATTGCCCGATCATA
CTGGGGCTAATGC

Sequences in the Contig:

SY0AAA53YB20FM1 SY0AAA61YD19FM1