Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1503
Length(NT) : 699
Best Gene Model Blast : Link to GSTUMT00003296001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1503
TTGGCATCCACCCAGTATGTAGGTTATTCCACGTTTCCCCCTTCCTCAAA
ACTCCACCCCTTCTTCCTCTTTCTTGCACACCAAGTCACCTCGCCGCGCC
AAACAATAAAACGATGGCTCCAAGACCTTACGAAAACAAATTCCGCGTCC
GCCGTCCAAACCCTACCTCAACACCCGCAGTCTACGCAGTCCCCTCAGGC
CCGCACCGCGGCGTTCATCTCCTCAGCAACGAGCCCCTCCCTTCCTCCAT
CCAATACATGTACCGCCACCCCATCAACGTCCACAAATCCCTCCTCACAA
TAGACCTGACCTCCACAACCACGGTTCCCAAGCGCTTCGACAGTATCGAT
GCAGCGCAACGGTATATCGACGCTGTTGATGAGAAGGGACAGGAGGCGAA
GGAGGGGGATTTGCTGGCGGAGCAGTTGGCCCGTGGGTTGACCCTGGGAA
GTGGGAGTGGGAGGAGGAGTGAACCAGTTTATAGAAGTTTGCCGGAGAGT
GTGAAGGGGAGTGTTAGCGAGAGGGAGAGGAGGGTCGAGGTTCTTGATGG
GATAGTGGGAAGCGGGAGAAGGGCAAGGAAGGTTGAGAAAGGGGGCTATA
GTCGAAGTCACACCGGGGTTGGAGAACGTGGGGGCGCGGCTGCTCCGGGT
GGAAGAGTGGAGAGCTGGAGGAGGGGAGTCGAGGAGAGGTTTGCCGCTC

Sequences in the Contig:

SY0AAA41YP09FM1 SY0AAA46YC16FM1 SY0AAA53YB02FM1
SY0AAC31YI06FM1