Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1502
Length(NT) : 819
Best Gene Model Blast : Link to GSTUMT00005521001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: COP9 subunit 3
Accession: ref|XP_755070.2| Score: 226 E_value: 4e-18
KEGG Definition: COP9 subunit 3, putative
Accession: afm:AFUA_2G07340 Score: 226 E_value: 2e-18
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG2582 Score: 185 E_value: 7e-15
PFAM Definition: No Hit Found
Swissprot: Q5B0Y2|CSN3_EMENI

Sequence:
>Contig1502
TTGGGATTTATTGAACCCCAGTTCTCAATAAACAACGCCCGGCGCCAACT
TGCCCCTTCCCTTTCCTATCAAGTAATTCCTGAGAGCGAAACTGTTCCTT
ATTCGTTATGGATAAACTTATCGACAGTTTTCTAAGCTTTCCGTCTTCAC
CAAACATTTCGGAGTCCGAGCTCCAGAAGCAGATCCAGAATCACCTCTCG
TTGCTGAATAGGGCCCCCGCTGCTACGCTTGCGTATCAACACGCCGGAAC
TGATGTGTTGGCTTTGTTGGATCCTTCGGTCAATAGCCTTGCATACCTCT
ATGTATTGTGCGTTTGGGAAAGCTGATTTGGGTTAATACCTTTTTGCTGA
TCGGTGGATTTTATAGGGTTGCCCGTATAGATCTCGGTCAGAAGGATGCC
ATGGAAGTTGTGTGGAGACAGGTTGTCACATTTCTCGAGACTTTCAATCC
GAAGCAAGTCCGGTGCGCACAAGATATCTTTAGACGACTGGTGGAATATT
TTTTCTCCTTTGCTACGGAGAGTGGTAAACCTATCATTGCCGTCCGCCCC
ATAAAGAAAGCGATTCTACGATTTAATCCCGCAAAGTTTTCCTTCCTGCA
TCCTCTCTTCCTTCGCTTGTGTTTGGAGGCCAAATGCTATCGTGATGCGG
CAGCAATTGTTGATATTGATATCGTCGAGTTTCCTTGTGCGAGTACTGGC
AAGGTGGTGGAAAATGCAAGGGCTGGGGAGGTTACATACCAAGATGTTCT
GACATACTTCCTGTATGCTGGAATGATTTACATGGGGATCAAGGAATGGA
GAAGGGCGGCGGATTATCT

Sequences in the Contig:

SY0AAA53YA12FM1 SY0AAB36YE12FM1 SY0AAD38YE13FM1