Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1501
Length(NT) : 769
Best Gene Model Blast : Link to GSTUMT00007067001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG02816.1
Accession: ref|XP_382992.1| Score: 299 E_value: 2e-25
KEGG Definition: hypothetical protein
Accession: fgr:FG02816.1 Score: 299 E_value: 8e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1501
TTGGGGAATTGCTCGAATTGGTGGCGGTTACTCGCAGATTATTGCGGATG
GTTCAGATGAACAGGATAGAGGTGGATGGGAAGGCAAAGTAGTGAAAATG
CTCAAGGCAGCATTGACAGAACATATTGATCATTATAGCCTGCAGGTCAT
TCACGATGGTTTTCACGAAACCGATGAGGAAGATAGTGATGATGAGGAGG
AGGAGTCCATACACCCCTCTGCTGTTACTCCTGGTACAGCCAATGCAGGG
AAAAGTATGCCAGCTCCTCAAGCACCAAAGAAACTTTCACTCCTCGATCC
CGATAGACATTTCGACATGACCTCCAAAATCCCTCCTTCCGATGACGAAC
TTCCCATCGGAAGACCCGCGGTAACTGAGTATCCTGGTTTTTCGGAAGAC
AGATTCTCACATCTGAAAAAGCTCGAGAACCCTGAGATACTCCAGGCACC
ATACCAAATTCCACCGCTATACTCACAAGTCCGGACTGTGGCTTATCTTC
TCATTTCTCCCAAGGGAGATCGTTCACTCCGAAATCCCACCTCTGTGAAG
CTGCAAGGAACCGCTCCCGGGATTGAAAGAGAGCAATTAATTCCGATCAC
CCGGCTTGCAGAGCCTGGTTTAACAATTCATCAACTCGCGGCACGTATGG
CTTTGAGAGATTTAGAGGATGGCTCAAGCTGGCTACACTCGGACAAACAC
GGAATCAATCACAAAGACGACACATTCAGTGAATATGTTGAGAGAGAAGG
GGAGTCCCTGTCGATTAAA

Sequences in the Contig:

SY0AAA38YG09FM1 SY0AAA52YP23FM1