Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1500
Length(NT) : 1165
Best Gene Model Blast : Link to GSTUMT00004023001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: ADL175Wp
Accession: ref|NP_983921.1| Score: 976 E_value: 1e-103
KEGG Definition: ADL175Wp
Accession: ago:AGOS_ADL175W Score: 976 E_value: 1e-104
KOG Definition: No Hit Found
PFAM Definition: Glyco_hydro_72, Glycolipid anchored surface protein (GAS1)..
Pfam Number: pfam03198 Score: 1044 E_value: 1e-114
Swissprot: Q08271|GAS4_YEAST
Gene Ontology:
GO:0009277 = Cellular component: fungal-type cell wall
GO:0042124 = Molecular function: 1,3-beta-glucanosyltransferase activity
GO:0030476 = Biological process: ascospore wall assembly

Sequence:
>Contig1500
TTGGACAACCCTTCACGACACTCTCTCTTTCTCCTCTTTCATTTTTCCTT
CCATTTTTAATTGTTCCCTCATCGTTTCGCCGGGCGTAAGCGGTATACAT
CAGAGGCGATACACTGTCCTCGTCCGCTGCTACCACAAGCAAACATACTA
TCACAACATTTAACCTAGTCAGCCCATCGGCATTGCAAAATTCTACTAGT
CGCTCTCTAACAGCATATTATTTCACAATCTACAAACATTCAAAATGCGT
TTTACTGTTGCATTTCTTGGTGCATTAGGCCTCCTAGGTGGTGTGACCAC
TGCCATTAACACAATTGAGCTCAAGGGTAGACACTTCATCGATAGCGTAA
CTAAGAAGGAGTTCTTCATCAAAGGTGTCGATTACCAACCTGGTGGTGCC
GCTAATGTCGAAAAGGGAGGAGACCCCCTGACCGATGCTGATAAGTGTGC
TCGTGATGTCTTTCTTTTCCAGCAACTCGGTATCAACACAATTCGAGTCT
ACTCCGTAGATCCCACCCAGGATCACAACGAGTGTATGACAATATTGGCC
GCTGCTGGTATATACCTGGTTTTGGATGTCAACACTCCGCTCGAACATCA
GCACTTGAACAACGAGGAGCCATGGACTACTTACACTTCCATGTACTCGG
AGCACATATTCAGCGTTATGCATGTATTCTCTGGGTATGATAACACATTG
GCCTTCTTGGCTGGTAATGAAGTTATCTTCGACCCCACATCCGCTAAGGC
ATCTCCCAACTATGTCAAGGCTGTTGTGCGTGACATGAAGGCCTACATCA
CCAATCAGATTCACAGACGAATCCCCGTTGGTTATTCCAACGCCGATGAC
TTGAGGTTCCGTACTGCTCTTGCTGCTTATCTTGAGTGCGGTGACACTGG
ATATATTGATTTCTGGGGTGTTAACTCGTATCAATGGTGTGGTAAGAACA
CCTTCACCGGGTCGGGCTATGACAAACTTGTTGAGGATTATAAGGACTAC
TCTCTTCCTATCTTCTTCACTGAGTATGGTTGTAACGAAGTCCGTCCCAG
AATCTGGCAGGAGGTCGACGCTCTTTACTCTGAGAAGATGACGGGCGTTT
TCTCCGGTGGTTTGGTTTACGAGTTCACCCAGGAGCCCAATGACTATGGT
CTCGTTAATATCACT

Sequences in the Contig:

SY0AAA27YF11FM1 SY0AAA44YO19FM1 SY0AAA52YP19FM1
SY0AAA63YC01FM1 SY0AAC9YI09FM1