Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig150
Length(NT) : 593
Best Gene Model Blast : Link to GSTUMT00011206001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001261511.1| Score: 228 E_value: 2e-17
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_7G05630 Score: 223 E_value: 3e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig150
TTGGGAGCTTTCCACGACCGTGCAGGAGCAAAACAACTGGTCATGAGGTC
ATGAGCAGAGGTGTTTGTCTACCCCAATGGAGCCCATTTATCTCTTCCGG
AACCTGCTACGTCAAGCCTCCATTCTTTTCGATGATGTCGCCCGTGCCCA
TACCGCCAAACTTATCACAAGCGGCTTTCGAAGAAATCAAAAGTTAGAGG
ATGCTTGGATTATCCACGAAAAAATCAAAAAAGGTCGTCAGGCTTTATCA
CTTCTACGACAGGCAAATTCTGGGGAGCCCAAACCACTGAGGAAGGTTCT
AGACCTGGCGTACGGGAGAGACGGTCACCGGAGGCGTGAGCTTTTACAGC
CCATTCTTGATAGAGCCACAAGCTCCGACCCTCTTATACCCGGCGTGCCT
CGTACAGCTCCTCCGCCAATCTCGGACGAATTGATGGCGTTGATGAAGCA
TCAGGTTGGAACGACAATCCACAGAGCTGAACCTGAGATACCGAAATTTA
ATGCTTGGGGGCGACCCATGCCCAAACGTCGTGTGGCTAATATGTTGCGC
CGACATAGGGAATATGTACTTAGACGATTGCTTCCTCCCCTGC

Sequences in the Contig:

SY0AAA15YI10FM1 SY0AAA16YM01FM1 SY0AAB21YM15FM1