Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig15
Length(NT) : 576
Best Gene Model Blast : Link to GSTUMT00009092001 E-value : 1e-160
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_08277
Accession: ref|XP_001590537.1| Score: 426 E_value: 2e-64
KEGG Definition: hypothetical protein
Accession: ncr:NCU07015.1 Score: 422 E_value: 3e-63
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3908 Score: 380 E_value: 1e-37
PFAM Definition: No Hit Found
Swissprot: O94460|TGT_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig15
TTGGGTACCAACTGCAGGGTACCGTACAGTTACATAACCGTCCATCTCTA
GCACCCGGTATGCTAAAGGCTTCCATGGCAACGATGAAGTCCATGCCATC
AGCTCTCAATTTTGAGCTTATCGCACGCTGTTCGACTACCAAAGCACGAG
CATCTATCTTGCGGCTTCCCCACGGCCCGGTGGAAACCCCGTTGTTCATG
CCCGTCGCGACTCAAGGGACCCTGAAGGGATTAACCCCGGAGCAGTTGGA
GAGCGTGGGGTGTAGGTTGTGCTTGAATAATACATATCATTTGGGACTTA
GGCCCGGACAGACGGCTCTGGATCGGATTGGGGGTGCGCATAAGTTGCAG
TCTTGGAGTCACAATATCCTGACGGATAGCGATGTGGAGGATAAAGATTC
CAAATGGTTTCCTTACTGCAATTAGCTACCGTTGCGGAACAGGGCGTCGA
GTTCCTGTCCCCGCATGACGGGACTCCGATGCTGCTTACCCCCGAACATT
CCATTTCCCTGCAGCACTCGATCGGATCGGATATAATCATGCAGCTGGAC
GATGTCATCGTTACCACCTCTCCGGA

Sequences in the Contig:

SY0AAA10YG15FM1 SY0AAA56YL01FM1