Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1498
Length(NT) : 1176
Best Gene Model Blast : Link to GSTUMT00005510001 E-value : 2e-07
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1498
TTGGCCAAAAGCATTTTTTGCAGGGTTACCTTGAATTTTGTTTTTCTGGA
GTTGAGAGTAATCCTTTTTTTACTTGATTTTATTTTTTGATTCCCTCACT
ATTGTTTCCCTCATTTTCCTTACCGTACTTTCTATTCTCTGTGAATCACG
AACAGGTTACTGTGATCCGGTGGGCCGGCTATACTCAGGATTTTTTTTCC
TTTTTGCTCCCTATATCCTCTTATCTCTTCATTCTTCTCTTTCTTCGTCT
CCCAAAAAAAGATATGAAGTAACGCAGCGAAGTCCGTTTTTTTTTCCTGT
TGCCACATTTTGTTTGAACCAAGTCCATCTTGTTGCAATCGTCAGGTGTT
CCCTCTGTTTTTTTCCCACGCTTTTCTCCTTTCTGCTCTATAGTTTTTAT
CTCTCTTTTGCCTTTGTCTTTTATTAAGGAACCCCTCCATTTTTTTTAAC
GAATATTTATATGAATGACCTTTTTTACCATTACCATATTATTCCGTTCC
GTTCGTTCTCGTCTCGTCCGTCTCGTTCATCCGTCCGTCCGTTCTCGTGG
AGCCAAGATTGGTGTGGGTGGAGTCGGAGAATGGAAGGAAACCAAGCCAT
GAGGAACAAGGCGGGCAGACGCAGGCGAGGAAGACAACCAAAATCTGTTT
TTACTTACCTCTTTTACTTTTTTTTTTTTTTTACCGTCTCTTTATTATCA
TTACGACGATTACGACATGATGCATTTTCTTGCCTTTTATTTTTATTCTT
TTACACCGTGGGAGGAGCAAGGCGGATCTTGTTTTGTTTTGTTTGGTTGG
GATGGGTAAAAAAAAAGAATTGGTTTGGTTTTGGGTTTCGTTGTGTTGTG
ATTGGACTGGGAATGATGGGGGGAGAAGGGGAGTGTTTATTGTTTGACTG
CCTCTGCCTACGATATCTATGGTATATTGAGCTTGAGTGGCCTACTCCTT
CTTTCTGCCTGTTTGCCCTGTTCTGCAATGCAGTGCTGGTGGTTAGTCTG
TGATAGACGAAGTGGTTACTCTTGCTAGCTTGGTAGTAGCTTGGTTTCTG
CATGCGCATTTTATAGCATACCGTACCTTACTTTGGTTTGAGGGTATCAT
ACTTTGATGTAGCGTTGGTTTTTCCTTTTCATGTGTCCATCCTCAGATAC
CAAAGATACCCCCCCCCTTCCCCTCT

Sequences in the Contig:

SY0AAA52YO09FM1 SY0AAB55YD21FM1 SY0AAC15YB04FM1
SY0AAD4YL06FM1