Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1497
Length(NT) : 973
Best Gene Model Blast : Link to GSTUMT00001850001 E-value : 0.0
Numbers of ESTs : 56

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9UT45|ENG1_SCHPO
Gene Ontology:
GO:0043187 = Cellular component: cell septum surface
GO:0009986 = Cellular component: cell surface
GO:0042973 = Molecular function: glucan endo-1,3-beta-D-glucosidase activity
GO:0016998 = Biological process: cell wall catabolic process
GO:0009313 = Biological process: oligosaccharide catabolic process
GO:0030994 = Biological process: primary cell septum disassembly

Sequence:
>Contig1497
TTGGGGGGACAACTTTGTACAAAAAAGTTGGATTTCCAGGGAAGCGCACA
CAAGCCAAATCACAAGCCATTCACTTGCCTCGTTCGATTCGATCTTTCAT
CTTCCTTATAAACCAGCCAAAGAAGCCTATCACACCTTCTCACACAACCC
AAACTCTAAACGAAAATGCAGCTCACTACCTACATCTTCGCGACCTTCGC
TATCGTCTCCGCTGCATTGGCGGTCCCCGTTGACAACCTGGTCGAGCGTG
ATACCAAGTACTGCGGTTACCAGCCGTACGAACCTTCAAAGTACACCTGC
TACGATGGCCTCCTCTGCCCTATCCAGAACTACGTTGTCTACAAGAGGTG
CGGGGGTGATTGCTACGACCCGGCCAAGTACGTCTGCCACGGCACCAAGA
TGTGCCCAACTACCGACCCCAACCTTTGCGGCGATGCTTGCTACAACTCT
TCCCGCTACAAATGCGAGTATGGACGTTTGGTCCAGGTTTAAGCACCCTT
GGCCATGACCGGCAACGCCGAGGTGGGGGGGGAGAAGAGGGGGAATGGAA
GGAGGATCGTGGGTACACTAAACGGATCCAAGCAATCTTGAGATCGCGCA
ATTTATATCTAGTGTTTTTTTCTTATGTTGGAAATAAGGGACGGGTGGTG
ATATGTGTTTGCGGGAGAGCTGTGGGCTGGGGGTTTACGTCTTTCGTTGG
AAACTTCATTGTATTGGACATGCTTCCTCGCTTACCTTTTGTTTTTTTTT
GGAAAGCGGCCATTACCAATCAGTAACGAAGCACGGATGATGAGGGGTTT
AATGAATTAATTGATGATTTATACCAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAACCCAACTTTCTTGTACAAAGTTGTGCGGCCCCAACTTTTTTG
TACAAAGTTGTCCCCCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTT
TTTGTACAAAGTTGTCCCCCCAA

Sequences in the Contig:

SY0AAA15YK08FM1 SY0AAA15YO06FM1 SY0AAA16YK23FM1
SY0AAA16YL01FM1 SY0AAA16YM19FM1 SY0AAA17YK02FM1
SY0AAA23YK01FM1 SY0AAA25YB01FM1 SY0AAA25YF10FM1
SY0AAA25YF10RM1 SY0AAA31YL23FM1 SY0AAA31YL23RM1
SY0AAA37YI13FM1 SY0AAA38YB21FM1 SY0AAA39YC03FM1
SY0AAA43YL02FM1 SY0AAA50YF22FM1 SY0AAA52YN24FM1
SY0AAA5YG16FM1 SY0AAA60YH22FM1 SY0AAA60YN16FM1
SY0AAA61YA11FM1 SY0AAA62YF14FM1 SY0AAA9YA18FM1
SY0AAB11YH11FM1 SY0AAB11YN16FM1 SY0AAB12YC17FM1
SY0AAB12YH23FM1 SY0AAB12YK13FM1 SY0AAB18YK03FM1
SY0AAB19YE02FM1 SY0AAB21YC11FM1 SY0AAB22YN24FM1
SY0AAB23YC06FM1 SY0AAB24YF20FM1 SY0AAB26YA17FM1
SY0AAB26YO10FM1 SY0AAB29YA12FM1 SY0AAB29YI21FM1
SY0AAB32YA23FM1 SY0AAB35YA10FM1 SY0AAB35YO22FM1
SY0AAB38YE01FM1 SY0AAB40YH09FM1 SY0AAB40YJ03FM1
SY0AAB41YO07FM1 SY0AAB47YD22FM1 SY0AAB50YP12FM1
SY0AAB53YO11FM1 SY0AAB55YI01FM1 SY0AAB56YB15FM1
SY0AAB5YI09FM1 SY0AAB60YO16FM1 SY0AAB7YC23FM1
SY0AAC54YK12FM1 SY0AAD46YD24FM1