Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1494
Length(NT) : 1315
Best Gene Model Blast : Link to GSTUMT00009867001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU01241
Accession: ref|XP_961607.1| Score: 660 E_value: 5e-67
KEGG Definition: hypothetical protein ( (AL513442) probable mitochondrial carrier protein ARALAR1 [Neurospora crassa OR74A] )
Accession: ncr:NCU01241.1 Score: 660 E_value: 3e-67
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0751 Score: 281 E_value: 1e-25
PFAM Definition: No Hit Found
Swissprot: Q9VA73|CMC1_DROME
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1494
TTGGAAAACTTCTCGCCATCCAGTGAAGGAGAAACATCGATAGTTGAAAC
CCATTTTTACCTTTTCCACGACTCCTGCAACTAATGCAAAGTGGGTGTTG
CGGCGGCACCATTCTCATGGAATGTTTTTTTTTTCTGTTGAGCTCACGTC
CATCTTAGAGTCACCCTTCACTGGAGGGACGAACAGGGCATCCCCCAACC
CTTACTCCTCGCTACCGACAAGGGATAGTGCAACCTGATGATGCCCCTGG
CGGTCAAACTTTGCCTTTTCGGTCCCAGCAAATCATGGCTGGAGAACCCG
TTCAACCTATCTTTCTCTTTACCAATTGTGCTTCTCTTCCAGCTCTTCCT
CTGCCTGTTCTCTCTTCTCCTTTCTCTAATTGTTTCTTAACCCCCTTCGA
CTCGATCTAGCGTGCGTTTGCCCCCCTCCGCTGGGCCGACTACTCCCCTC
AAGCCTCTTTCCTTCCTCACCTTTTTGTCAACTCCACTCACTCCTTTTTT
TTCTTTTTTTGCTAATTTCTCATCCATTCAACTCCCCCTTCCTTTCCTTC
CTACGTCCTTCCTGTTTTTCGCAGGGATATTGTTCGCTCAAGTGGTGTTG
CTCACGGAAAGGATTTTTGAAGAGCCCCATTTCGCCCCAAAACAATGGCA
GCTGTGCCACCGCAACCCATCCAAGATTCTTTGCTCGGGGTCGGGCAGCA
GCCGACACTCACTTCCAATATCAAGGAGAATTTCGAAAAGTTTGCATCAA
TTTTTGAACCGACTACTGGTGAGAGGCTGATGACCAGAGAGAATTTCATT
GATGCGATCGCGCCCCCGGATCAGGATTTCCACAAAATTAAACGAGATCA
GTACTCGATCCTCTTCGATATCGCGGATAGGCGCAGACAAGGTGTACTGA
ACATTCAAGACTGGGCAACGTTTGAAGACCTTCTTGCCAAACCTGATGCG
GAATATCAAATCGCCTTCAGACTTTTCGATGTGGAGGGAAGTGGTTGTGT
GAAATACGATGACTTTGTGACGTTCTATACCCGCAGCAAAGGGCCCAGTA
GCCTACCTTTTGATTGGACCAGCGAGTGGGTTGCACTTTACCTTGGGGGT
AAGAATGGCCGAAGGAACCTTTCATATCCTCAGTTCTCACAGATGCTTCG
AGGACTTCATGATGAGCGTGTCAGGCAAGCCTTTTGCCTCTATGACAAGA
ACAAGTCCGGCTCTATTGAGCCCGAGGACTTCGAACGAATTATTCTTGAG
ACTTCGAAACACAAACTCTCCGATCATCTTCTCAACAATCTCCACACATT
ATCCCACATATCGGC

Sequences in the Contig:

SY0AAA22YO06FM1 SY0AAA52YM18FM1 SY0AAC53YE22FM1