Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1493
Length(NT) : 1003
Best Gene Model Blast : Link to GSTUMT00008046001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein FG05221.1
Accession: ref|XP_385397.1| Score: 805 E_value: 5e-84
KEGG Definition: hypothetical protein
Accession: fgr:FG05221.1 Score: 805 E_value: 3e-84
KOG Definition:
Classification: [Coenzyme transport and metabolism, Amino acid transport and metabolism].
Kog Number: KOG2790 Score: 633 E_value: 1e-66
PFAM Definition: Aminotran_5, Aminotransferase class-V. This domain is found in amino transferases, and other enzymes including cysteine desulphurase EC:4.4.1.-..
Pfam Number: pfam00266 Score: 140 E_value: 2e-09
Swissprot: Q10349|SERC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1493
TTGGAACTTTAGTGGGGCGGCCCTTCCCTTCTTCCTATCATACTCCTCCA
CCCACCAGGCCAACATATATATTCTCCCAATCTCTCCAAAAAAGAAAAGA
AAACAAAAATAATCTTTACCCTCCAAAAAATCATATACCAGATTCTCCAA
AAATGCCCGCCCGTGACGAGATAACCTACTTCGGCGCTGGCCCCGCAAGC
CTCCCAACTACCGTCCTCCAAAATGCCTCCTCTGCAATCCTCAACTTCCA
AAACACCGGCCTTGGCCTAGCCGAGCACTCACATCGCTCCGCCCTCTCTC
ATGGCATACTCGCATCCACCGAATCCTCTCTCCGTACTCTGCTGTCAATC
CCGGAAGACTACACTGTCCTCTTCATGCAAGGCGGTGGAACCACTCAATT
CTCCGCAGTAGTATACAACCTACTAGGTTACTGGGTGCAGAGCCAGCTCA
ACAAAGCTAGCGGGGACATCGAGGTCGTCCGCGAGAAGCTCAAAAAGGCA
AGGATGGACTACGTTGTTACAGGAGGGTGGAGTCAGAAGGGGAGTGAGGA
AGCGAGGAGGCTGTTTGGGGAGGAGAAAGTCAATGTGGTTACCGATTCGA
GGAAGGTTTTCGGAAGATATTGTGGGATTGAAGAAGAGAAGGGGTGGAAG
AGGACTGAAGGGGAGGAGAGAGTTTTCACGTACTATTGTGATAACGAGAC
GGTTGACGGGGTGGAGTTTCCTGGGTTTCCAAGGAGCTTGGAGGGTGGGG
TTGTGGTGGCGGATATGAGTAGTAATATACTCAGTCGTAGAGTGGACGTT
TCAAAGTTTCATGTCATCTTCGCTGGCGCACAAAAAAACATCGGGATAAC
CGGCCTCACAATCGTAGTTCTGAAATCCTCAATTCTCCAAATCCAACCAA
CCCCAGGCACGCTCCGCGCCTTGGGCCTCCCCGTCCCGCCAGTAATGATG
TCCTACCCCAGCCTGGCAAAGCACAATTCCCTCTACAACACCCTCCCCAT
CTT

Sequences in the Contig:

SY0AAA52YM15FM1 SY0AAC23YO19FM1 SY0AAC29YH07FM1
SY0AAC2YA07FM1 SY0AAC59YF02FM1 SY0AAD15YJ18FM1
SY0AAD17YP21FM1 SY0AAD24YI01FM1 SY0AAD28YF02FM1