Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1492
Length(NT) : 1528
Best Gene Model Blast : Link to GSTUMT00008050001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_03226
Accession: ref|XP_001595138.1| Score: 936 E_value: 6e-99
KEGG Definition: hypothetical protein
Accession: ang:An14g06520 Score: 922 E_value: 1e-97
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG2167 Score: 993 E_value: 1e-108
PFAM Definition: Cullin, Cullin family..
Pfam Number: pfam00888 Score: 543 E_value: 5e-56
Swissprot: Q13620|CUL4B_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0007049 = Biological process: cell cycle

Sequence:
>Contig1492
TTGGCTCCCTTGCGGAGTACCTTGACCGTTCTTACCTCCTTAACAATGCT
AATCCGAGTCTTCAGCCTGTGGAACCCACCGGGCTAGAACTCTTTCGGCA
CCATATAATACTGGCCCAAGAAATAGAAACCAAATTTATGGATGGAATCA
TGGCTCTGTTCGAACGCGATCGCCAGCAATGCTCAATCGACGCTTCTCTG
CTCACACGTGCCGTTCGCATGGTGGATAGTTTAGACCTCTATGAGACGAA
CTTTGAGCCCCGGTTCCTGGCCATGTCTAGAGAATATTACGACCGCCTTG
GGATTCTAGGGGCAACTTCTAACTCCCTTGCGGAGTACCTTGACGAATGC
TCTCAGCAATTACACAAGGAGGCATTAAGATGCGAGAGGTACCGCTTGGA
TCCGCCTACAAAGCGATCTATGGGGCTTATACTCGAGGAGGGATTGTTGA
AAAACCAATTACTTATCCTCACTGATCAGGGAAGTATCGAGGATCTTTTA
CAAAAGCAAGATCATAAATCCTTGGCGACCCTTTATAGCCTTCTTGATCG
GATAGGGGAGCCGAGCAGCTATCTAAGGCTGGCATGGGAGAAACATATAC
TTACTGTGGGTAGAAGTATAATCGAGGACGAGAGCCGAGAAAACGAAATG
GTGCAGCGGCTTTTAGAGCTTAAGGATAGCCTAGATTCTTTTGTTAGGGT
GCCGTTCAAGGGTGACGATACGTTGGCTTATGCTTTGAGGGAGTCGTTTG
GAACATTCCTCAATGCGCGCACCAAGGATCGATCAGAGATGGTGAATTCA
AAGCCGGCTGAAATGATTGCGAAATATGTCGATGCGCTGCTAAGAGGGGG
TGCCAAAGGAACCTCTACAGGGACGCCTGGTGATGAAGATGCTAGGTTGG
CCCATTCGCTGGAGCAGGTCCTTGACCTGTTCAGGTTCATCCAGGGGAAA
GATGTGTTTGAAGCGTTTTACAAGAGGGATCTTGCAAGGAGGCTATTGAT
GGATAGAAGCGCTAGTCGAGATGCTGAACGGAGCATGATAACCAAATTAA
AAACCGAGTGCGGATCCGGATTCACTCAAAACCTAGAGAGCATGTTCAAA
GACATTGAAATATCTCGAGAGGCGATTTCGCATTTCAAAACGACAAGGAA
CCGCGCGGGGAATTCTCCAAATGTAGATCTCAACGTTCTAGTACTTTCTC
AGTCAGCATGGCCAACCTATGACGAGGTGCCGGTAGTTATTCCACTTGAG
ATGGCGCAATATCTAGAATCCTATAGAAATGTCTACTGCGAAAAACATAG
TGGAAGGAAGCTCATGTGGAGACACGCGTTGTCACACTGTGTTCTAAGGG
CGAGATTTGCACCGAATGTGAACAAGGAGCTAGTTTTGAGCGCCCTCCAA
GCAGTAGTCCTCCTACTATTTAATGATGCGGAATTTGGAACCTACCTCTC
ATACCAACAAATTAAAGGAGGCACCGGACTAGACGACAAACAGCTAATTC
GCACCCTCCAATCCCTCGCGTGTGCTAA

Sequences in the Contig:

SY0AAA16YB08FM1 SY0AAA20YL19FM1 SY0AAA23YG09FM1
SY0AAA49YC11FM1 SY0AAA52YM09FM1 SY0AAA8YE07FM1
SY0AAB58YL06FM1 SY0AAD25YM15FM1