Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1491
Length(NT) : 597
Best Gene Model Blast : Link to GSTUMT00011219001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_08373
Accession: ref|XP_001798688.1| Score: 626 E_value: 1e-63
KEGG Definition: conserved hypothetical protein [EC:3.4.21.89]; K03100 signal peptidase I
Accession: mgr:MGG_00113 Score: 598 E_value: 1e-60
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3342 Score: 568 E_value: 2e-59
PFAM Definition: No Hit Found
Swissprot: P15367|SEC11_YEAST
Gene Ontology:
GO:0005787 = Cellular component: signal peptidase complex
GO:0005515 = Molecular function: protein binding
GO:0009003 = Molecular function: signal peptidase activity
GO:0045047 = Biological process: protein targeting to ER
GO:0006465 = Biological process: signal peptide processing

Sequence:
>Contig1491
AAAACGTGACAACAACGATAACCTCATACCCCCCCCTACATTTTCACCCC
AACCTTCAACAGACCACACAGCAAACATGGATGCCTTGGGCCTCTCTAAG
CTACGGCATCTAAAACCACGACAACTCCTTTCCCAAGTCTTGAATTTTGC
TTTGATACTTTCAACAGCGTTCATGTTATGGAAGGGTCTGTCGGTCGCAA
CTGATTCGCCCAGTCCCATTGTCGTGGTTCTGTCAGGGAGTATGGAACCG
GCATTTCAACGTGGGGATCTATTGTTCTTATGGAACCGGAATTTGGAACT
CGATAGCCCCCCTACACCTGGAACGCGGGTCGGCGAAATTGTTGTGTATA
ATGTCATCGGGAAGGACATTCCTATCGTCCACAGGGTTGTGCGAAAGCAC
CAGGGGCCCAAAACACCTCTCCATCTCCTTACCAAGGGCGACAACAATCA
CGCCGATGATACCGAGCTCTACGCACGCGGCAGGTGGTACCTTGATCGTG
AGAAGGAAGTTATTGGAAGTGTGGTTGGATACGTGCCTTTCGTAGGCTAC
GTTACCATTATGCTCAGTGAACACCCCTGGATGAAGACAGCATTATT

Sequences in the Contig:

SY0AAA52YM08FM1 SY0AAB22YI18FM1 SY0AAB50YB21FM1
SY0AAD2YH11FM1 SY0AAD35YJ09FM1 SY0AAD50YG15FM1