Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig149
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00002035001 E-value : 2e-98
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig149
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTCACCATACACCCCAGGAA
CGTCACGCTCACTCATCGGGTTGAAAGCACTTAAAACTGCCTCATACAAC
TATTTTCCCTGGGTAGCTGGTCTATGTCTATTTCGCTAACTTCATAAGTG
AGGCCTCATCTCCTCCCCGTTTCCGGAAGGAAAGGATAAAAAGGGATCTC
AATTCTTGCTTATTCTCTTTTCTGCTGCGTTAGACTTCCGCTTGCTTCCT
CTGTGGTTGTTGCTTTTGACTAAATTGGCCATTTTCTTCTTCTTTTCCTT
CGTTTCCTTTTCTCAACTTTAATCTTTCCCTACTCCCCCCGCCGATTCGC
CTTCCCACTATTTTTCTTTTCTTCTCCCAACAATCGAGCACCCTTCCGAC
CTATAGTTAACTTTATCGCCCCTCATGACGAGTGTTCAACAGCCAGTGGG
CCCTGCGCTCCCCGAAAAAATGAGTCAGCCAGAGAAACGGCCTCGTGGAA
GACCTCCGACATTTACCGACGAGGAACGACTTCAGCGGAAACGGGAGCTG
GCTCGCGTACGTCAAGCACGGAAGAGGGAGCGGGACAGGGTTAGGAGATG
GAGCACGGGGCAAGGCAGTGAAGAGATGGGGTCACAAGGAATTGGTTTT

Sequences in the Contig:

SY0AAA15YH08FM1 SY0AAC32YC14FM1 SY0AAD57YD09FM1