Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1489
Length(NT) : 796
Best Gene Model Blast : Link to GSTUMT00011300001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An18g02440
Accession: ref|XP_001398704.1| Score: 237 E_value: 3e-18
KEGG Definition: hypothetical protein
Accession: ang:An18g02440 Score: 237 E_value: 1e-18
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1943 Score: 205 E_value: 3e-17
PFAM Definition: No Hit Found

Sequence:
>Contig1489
TTGGGTTGATTCACGAGGTGATGTGGGCAGTTGGGTGCGCTCAGAAGGGG
TCAAGGCTGTATTTGAGCACTGGGAACGCTTAGGAAATGAAGATGCCCAG
TGGCAGATTCTAGAAAGAATAGCTCGTCTCTGTGCGGAAAGACTCGACCG
AGTTCGAGTGAGGGCATGTGAAGCACTTGTGAGAATATCCGAGAGTGAGA
AGTGGAAGGATCTAGCTGAGCACATCAATATCGAAGTGCTTAAATCAGAG
ATATCAGCCACTTCTGTCTCATCGCCTGAATACTTCACTTCTCTGATATT
GCTGTTAACCCACCCGCGCCTCTCAACGCCATTTCTCAAAGGTCTTGTAC
TCTCGGCTGGTGCAGGGTCGGACAGCCTATTAAAGACTTCTCGGGCAGCT
CTTCTATCCTTTCTATCAAACACTTCTCCAACACCTATCCTAAGTACCCT
AACATCGCTCCTACCACATGAAAGGACCACAATCCCAACACTAGAGGTCA
TGTCGGCGATTCTGGAATCAATTCCCTGCGCCCCTCCTGCAAGCCTGTTT
CCTTCTGTTCAAAAGTCACACTATAAAAGCGCCAATCACGGTAGATTATC
TACCGCAGTGAGGGTTTATGGCGGGATATACATGAACGAGGATAAATCGG
GAAGAAAGGCTGTGGTTGACAAGCTCGTGGCTATGCTAAATCACCCATTC
CCAAAGATCAGAGAGGGGGCTGCAGAGGTTTTAGTCGGTGTTGTCGGGTG
TTTGGGAGATGAGATTAATGGAAAGGCCATTGAAGCCTTGGCTGGA

Sequences in the Contig:

SY0AAA52YL03FM1 SY0AAC32YO13FM1