Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1488
Length(NT) : 1543
Best Gene Model Blast : Link to GSTUMT00011875001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001239480.1| Score: 790 E_value: 5e-82
KEGG Definition: hypothetical protein
Accession: ang:An01g08980 Score: 783 E_value: 2e-81
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3319 Score: 547 E_value: 2e-56
PFAM Definition: ORMDL, ORMDL family. Evidence form suggests that ORMDLs are involved in protein folding in the ER..
Pfam Number: pfam04061 Score: 568 E_value: 7e-59
Swissprot: P53224|ORM1_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0006986 = Biological process: response to unfolded protein

Sequence:
>Contig1488
TTGGCCTTCTTCCACCTCTCTTGGTGTTCGATTGACCCTTCCACCATCTC
TCCCTACAATCACTCTTTTAATTATTGACCTTTCACCCTTCTTCCCTCCT
CCTTCTATTCTTTTTTTCCCCTTCTTTTCCTTTCCTTGACCTACCCTTCC
ACCCCCCGCACGAACTGTCACCAAAAAGGCAAAAGGAAAAGGCAAAAAGT
TAAAAATTAAAATAAGGACCCACACTCGCTTTAATCCCCCGGCCCTACAA
TTGCTGCCCTTAACCCCCTTCGCTCTCTCATCAATTCCGTTTCGCTTCCG
ACACCCGTGTCCTTTTTGAGATCTTCCGGTTCTATTCAGCCTCCGGAGCA
TCTCTCGTACACCTCCTTCCCCACAACCTCTGCTATCATACCCATTCAAG
CTTACTCAACCCGACTTCCTTCCCTCTACACTCTCTCAGCCTCATCCCTA
TCTCTAAGCCCCTCCCCACCTCAGCTCAACCCAACCAGTCGCCTTATACG
GCCATCCCCACCACAAGCTTTCAAAATTCCTTCTCTTCTCCTTCCCCGCA
CAACCCCTCCTGGCGCCATGTCGGACGCCGCTCATGGACGGAGACGTCGC
TCAAGCTCGCTCATATACACCGAGCCTCCAGAGACGATCGAGCAGCAGTC
TGATCAAGCTGCTCTTCCAAATTTGAATGCGAGCTGGGTCAACAGTAAAG
GTGCTTGGACGATCCATGTCGTCTTGATCATCGCTTTGAAGATATTCTAC
GATACCATGCCCGGGGTGTCACAGGAGACTAGTTGGACCTTGACCAATAT
CTCCTACATGGCTGGCTCTTATCTTATGTTTCATTGGGTTCAAGGCATTC
CTTTCGAGTTCAACGCGGGGGCATACGATAATCTCAACATGTGGGAACAA
ATCGACAATGGCGATCAGTACACTCCGACGAAGAAGTTTCTATTGACGGT
ACCGATAGTACTGTTTTTGATGAGCACACATTACACACATTACGACCTCA
CTTATTTCATCATCAATTGTTTGGCGGTACTGGCCGTTGTAATTCCTAAA
CTACCTTCCAGCCACCGCATGAGAGTGGGTCTTTTTACGGTTCCCGAGGA
GTAGGCGTCGTCCTCAGCACGAAATAAAGACTGGTTTGGGTTTGCGATTC
AATTCGCTAATAAAAAATAAAAATGAAAAAACACCGGCGTTGAATTGATT
TTTACTGTTTTCTCACTAACTAATCTCCTTGTGCTCTGTATCCTGGCATC
ATTTTCCCCTTCTCTTTTCCGCGTGGTACTCTCATTTTCGGGCTGTCTTA
GGTTTTGTCTTTTATCTGTTTTTTGCTCCGAGCACCGCGTCGGAGACCAT
CTATACGAATCTCCTCAGGGTTTTCTCCATGTTTTTCCCCCCTCCAAGTT
TTTAGTCTTTGTTCTGCTTCGGCCTCGTACTTTTTATAACTACTACAGAT
TTTTCTCTCTCTTTTTCTGATTCTGTTTTCTTGAGTTTTGGTATAGCGTT
AGCTTATATTCTATTTTTTCCTCTTTTTCTCTTTCTTTCCTCT

Sequences in the Contig:

SY0AAA12YG22FM1 SY0AAA52YK22FM1 SY0AAA5YO22FM1
SY0AAB48YE14FM1 SY0AAC2YK16FM1 SY0AAD40YA07FM1
SY0AAD52YC23FM1