Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1487
Length(NT) : 893
Best Gene Model Blast : Link to GSTUMT00011409001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein NCU04737
Accession: ref|XP_960372.1| Score: 437 E_value: 2e-41
KEGG Definition: hypothetical protein
Accession: ncr:NCU04737.1 Score: 437 E_value: 1e-41
KOG Definition:
Classification: [Chromatin structure and dynamics, Transcription].
Kog Number: KOG2684 Score: 209 E_value: 1e-17
PFAM Definition: SIR2, Sir2 family. This region is characteristic of Silent information regulator 2 (Sir2) proteins, or sirtuins. These are protein deacetylases that depend on nicotine adenine dinucleotide (NAD). They are found in many subcellular locations, including the nucleus, cytoplasm and mitochondria. Eukaryotic forms play in important role in the regulation of transcriptional repression. Moreover, they are involved in microtubule organisation and DNA damage repair processes..
Pfam Number: pfam02146 Score: 118 E_value: 5e-07
Swissprot: O94640|SIR2_SCHPO
Gene Ontology:
GO:0000775 = Cellular component: chromosome, pericentric region
GO:0000781 = Cellular component: chromosome, telomeric region
GO:0031934 = Cellular component: mating-type region heterochromatin
GO:0000790 = Cellular component: nuclear chromatin
GO:0032129 = Molecular function: histone deacetylase activity (H3-K9 specific)
GO:0046970 = Molecular function: NAD-dependent histone deacetylase activity (H4-K16 specific)
GO:0030528 = Molecular function: transcription regulator activity
GO:0030702 = Biological process: chromatin silencing at centromere
GO:0030466 = Biological process: chromatin silencing at silent mating-type cassette
GO:0006348 = Biological process: chromatin silencing at telomere
GO:0007059 = Biological process: chromosome segregation
GO:0016571 = Biological process: histone methylation
GO:0008104 = Biological process: protein localization

Sequence:
>Contig1487
TTGGAGCAAGCGGTATGTCGCTGGAGCACAGCTCGTGTTTCCTTAGGGTG
AGGCAGCCGTCAGTACAGTACTTGACAAAGTGAGCCAAGAGCCACTTGGC
CGTTGTCGACCACCCGCCGCCACAAGCCGGGCACCAGCCACGCGTTGCTT
GCCTGAGCGCCACACCCCGAATCCTCCTCACTTTTTCCCCCTTCAAACCA
CGACAACAACCCCCACACCTCGTGCACGATAACCTTCGCTCGGAATATGG
CAACCATACCCATTGCGGGAGCGCCAAATGGGGCGGAATCGACTGCACGC
GTAGCGGAGTTAGAGGAAGTGGAGGCACTCCCAATTGGTGGCATAGAGGA
AGAATTCTACGAGGACGACGACGATGATGGGGAGGGGGATAACGAGGACC
AGGAGTCGGGAGCCGACGATGGGACGGACTGGGACGTTAGCTCTGTTTTT
GATGAATGGCTTGCACAATCCACCGAGCCAGTAGTGTTTGCACCTGAGGA
AGATGCGGTGACAACGGAGGAGGGGCGCAATCTCCGCGATTTACTCAGAA
GGGTTGGAGAGGCTAGGTTTATCGAGGAGACACTTCACACGGGGTCTTTC
ACTGCCAAAAGATTGCTGACCGCCTTTGGTGTCCGTCCGCCTTTCTTTCT
CGAGGGTTCCCCGGACATGGCATACCTTCCTCTTCTCGGCATGGTGATAA
CTAGAGACCTTAGGGCGAGGCAGAAATTGACACAGCACAACACGTTGGAC
GACGTCGTCAAACTCTTGAAGGAGTCAAGCAATATTATCGTGCTTACAGG
TGCTGGGATTTCCACAAGTTTGGGAATCCCAGACTTTAGATCCAAAGGAA
GCGGTCTCTATTCCCGCCTGGAGGGATTAGGACTTTCGGACCC

Sequences in the Contig:

SY0AAA52YK20FM1 SY0AAB51YI08FM1 SY0AAB7YI07FM1
SY0AAC50YB12FM1