Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1484
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00011585001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_01881
Accession: ref|XP_001559725.1| Score: 256 E_value: 1e-20
KEGG Definition: hypothetical protein
Accession: ang:An04g06590 Score: 240 E_value: 4e-19
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2966 Score: 123 E_value: 9e-08
PFAM Definition: DUF607, Protein of unknown function, DUF607. This family represents a conserved region found in several uncharacterised eukaryotic proteins..
Pfam Number: pfam04678 Score: 128 E_value: 2e-08

Sequence:
>Contig1484
TTGGGGTTTGGGGTGGGATGTCATGGAGCCGGTGGCCTACCTTGTCGGCT
TATCCACCGTCATTGTCGGATATCTCTTACTCCTTTACGGTGGCCGCGAG
GTTCCCTGCCGGTCTGTCCCGCGTATGGATGTGTCGAAACGGCGGATGAA
GCTCTACCGAGAGAAGGGGTTCGGTGTTGACAAGTGGCAGGAGTTAGTCA
ATGAGGGCAGGGCTTTGCGCAAAGAGATTAAGGCCATAGCAGAAGAGTAC
GACGTCGACTGGGATGAGCGGAGTGATGGAGTTGGTGGAGATAAAGTCAT
CAATCCTCTGGCTGAAGGTGCAAGGGGCGGAGAAGGGGAGGGTCGGGGAA
CGCAGAAGTGGTAGGAGGAAGAGAGGGAGAAGGCAACGAAGAAGTTGGGT
CCCCACCATTCGTGGTTGAGTGAACGTGTATACATGTTCTCGTTTCTTTT
CTTTTTTGGGTTGGAGTTTGGGCTGCGTTTACTGTTCATCACGTTTCACC
ATATTTTCCTTGCACTAGGGGCATATCCGTGAGTGCTGTAAAGAGCGCCG
TGCCGTGCTCGAGTATAGCGCAGCCATTTATCGCTCTCTCGTGTCTAGCA
TCGATATCATAGCATGCAAGTTATAGGATCAAATTACGTCGGCATGATAC
CGGTACATGT

Sequences in the Contig:

SY0AAA52YI20FM1 SY0AAB2YO12FM1