Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1483
Length(NT) : 1388
Best Gene Model Blast : Link to GSTUMT00004444001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: hypothetical protein CIMG_07859
Accession: ref|XP_001240696.1| Score: 619 E_value: 3e-62
KEGG Definition: predicted protein
Accession: aor:AO090011000716 Score: 587 E_value: 8e-59
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2342 Score: 275 E_value: 6e-25
PFAM Definition: DUF833, Protein of unknown function (DUF833). This family is found in eukaryotes, prokaryotes and viruses and has no known function. The mouse Ser/Thr-rich protein T10 has been found to be expressed during early embryogenesis..
Pfam Number: pfam05742 Score: 419 E_value: 1e-41
Swissprot: Q29RZ5|CV025_BOVIN

Sequence:
>Contig1483
TTGGACTGACTGCCGTGTCAATTCTGAAAGAAACTACAGCTCTCCAAAAG
AAATTCTCATCAAACAAACAGCTTCCCCCACCATCCTGGTAATGTGTATC
CTACTACTTACCACCGCCCACCCCGACTACCCTCTTATCGTCCTCAACAA
CAGAGATGAGTTCCTTCATCGCCCGACACAACCAGCCGCCTTCTGGGAAC
CCCCGTACTCCCATATATTCTCGGGTCGAGATCTCGCCCGTCCTGAGCAC
GGCACATGGCTAGGAATCACTCGCTCCGGGCGCCTAGCCGTCCTAACCAA
CTTCTGCGAGGATTCGTCTGCAGCGGCAATTAGCCAAAAGTCCCGCGGTT
CAATAGTAACATCGTTCCTGACGTCACACGAGGACCTCAATGGCTCTACA
GAATCATGGCTCCACCGGCTCCTTGCAGACGGAAAAATGAAGGGCGTGGG
AGGGTTCTCCCTCTTGTGCGGAATCCTGCGTCCAAGTTCATCCAGTAGCG
ACCCGAAGGCAAACTTGGAAAAAATTGCCGTGGTCTGTAATCGAACCGCC
GCTGGTGACGAAGGGGTCGAAAGCAGCGCACATTGGATTGCAGGCAGCAA
AGGCGAGACCCATGGCCTAAGCAATTCGTTATTCGACGATCCCTGGCCAA
AAGTGGTGATCGGCAGAAATTTGCTCGCAGAAACCATCGAGAACTCGGCC
GGAAAGTCTGAAGATGAATTACTGGAGGGTCTGTTTGCTATCCTTAGCCA
CGATACGATGCCTGTTACGAGGGGGAAAGATAGTGCGACGCAACTAGAGG
CTCTGCGACACTCCATTTTCATCCCGACGTTCGAAACCTCCCCCGAGACT
CCCGAAACGAACGGCCATGATGAATCCGTTGCTGACGAAAGTCGTGGCGT
CGAAGTTGCAGCCAACAGCGGTGATAGAGTGGAGCACTACTGCGCCACGC
CAGATGAGGAGGAACACAGATGGATCCATCCTGAGAGACTATACGGAACG
CACAAGCAGACCGTTATACTCCTTAACAAGAATGGGAAGGTAAATTACGT
TGAGCGAACGCTATACGACAACGACGCGAAGCCGGTAGACAGGAAGGATA
GAGACATTGTATGCAAATTTGATATCGACGGGTGGGATGATGTGCCCACT
ACTACAGCATAAGTAGAAAGGAAGGGCTTATATCACACAAGCCGAAATTC
AGGAAGTGATCTTCATTTGCTATTTCGTGCCAGTCCTTTTCAACTACTTT
CACTCAGAACCCTCCCCGTAACATCCATGTATCATCTTGTCTTTTCTTCT
CTCCCTCTCTCCCTCTCGGGTATACTCTCGACATCATGTACTGTACAATC
ATCTCACGCAGTTTACAATCAAAACATCATAGTCTACT

Sequences in the Contig:

SY0AAA52YI05FM1 SY0AAA6YG19FM1 SY0AAB47YN08FM1
SY0AAC10YP10FM1 SY0AAC19YN13FM1 SY0AAC39YF16FM1
SY0AAC46YL15FM1 SY0AAC4YC18FM1 SY0AAC4YF13FM1
SY0AAC56YD23FM1 SY0AAC61YE13FM1 SY0AAD12YB19FM1
SY0AAD24YK06FM1 SY0AAD29YG04FM1 SY0AAD33YN04FM1
SY0AAD46YO12FM1 SY0AAD63YE04FM1 SY0AAD7YO16FM1