Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1482
Length(NT) : 1306
Best Gene Model Blast : Link to GSTUMT00008539001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein MGG_13726
Accession: ref|XP_365447.2| Score: 312 E_value: 1e-26
KEGG Definition: hypothetical protein
Accession: mgr:MGG_13726 Score: 312 E_value: 6e-27
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 168 E_value: 1e-12
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 202 E_value: 1e-16
Swissprot: Q92396|TYRO_PODAN
Gene Ontology:
GO:0004503 = Molecular function: monophenol monooxygenase activity

Sequence:
>Contig1482
TTGGATTTGAGTAGGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTA
TGCCTGAATAGGGCGAAACCAGTTGCCCCCCTAAATTTACTTGTGTCCGG
GTAAACTCTTACTATTCCACTTGTGTGGAGACCGAATATTACCCCTCGGT
TTATAATCCCACCGCTAGTCAATACACTGACTCCAACTATCATCCCTCGG
GTTATACCTACAACCCATACAAACATTATACGTCAACTCCCCCAAAATAC
ACTACTAATACATACTACACCCCGCGCCCAACCAACACATACAAGTCGTC
GGATCCCAAGCACAAGACCGACTACAAGCCATATCCGACTGACTATAAGC
CCTACCCATCGGACTACAAACCGGATGACTGTCAGTCGTATCCGTACCAC
AAGCCAGATTATAAGCCATCCGACTACAAGCCGTACCCGGATTATAAGCC
GACCGACTACAAGCCAGATTATAAGCCATCCGAGTACAAACCGTACCCTG
ATTATAAGCCATCCGACTACAAGCCGTACCCGGATTATAAGCCGACCGAC
TACAAGCCATACCCGACCTATAGGCCGGATTATAAACCATCTGACTACAA
GCCGTACCCGACCTATAGACCGGATTATAAACCATCCGACTACAAGCCGT
ACCCGACCGACTATAAGCCGGATTATAAGTCACCCGATCCCTACAATCCG
TACAAGCCATACACCACGGAACCTTATAAGCCATACAACTCGGATCCACC
ATACAAGCACTGCAAGAACGATCCTTACAAGCCATGCCCCGACGATGAAT
ACAAGCCGCAACCCAGGGCTGTCGTCCCCAGACAGTCTGGCGCACCCGGT
GGCTTTACTCCCGTTACTGGTGCACCTGGCCTGCAGACGCGTATGCCTAT
TGAGGAGATGCAGTCAAATTCCTCTGATGTCTACAACATGTTCATCCTGG
CTTTGGTGGCCATGCAGGCAGAAGATGAGAATCGCGACGTAAGTTATTAC
CAAGTCAGCGGTATTCATGGTCGCCCATATCTTCCATGGCAACACGAATT
TGATCCTGCTAGCAACGATCCCGGCCGCGGTTATTGTACACATGGAAATG
CTTTGTTCGCTACATGGCATCGGCCCTACCTCATCCTGATCGAGCAAATC
CTTTGCGAACACGCAAGAACAATTGCAGCACGATTCACTGGTGCGGATGC
GCAGAGATATCGTGATGCTGCTGATAGAGTGCGCATGCCGTATTGGGATT
GGTCTTCTCAGACAACCAGATCACGTCTCCCGAGTGCCGTAACTGCGACG
GATGTC

Sequences in the Contig:

SY0AAA20YJ01FM1 SY0AAA27YE23FM1 SY0AAA52YH24FM1
SY0AAA57YM21FM1 SY0AAA63YI22FM1 SY0AAA6YI15FM1
SY0AAB3YG23FM1 SY0AAB59YF20FM1