Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1481
Length(NT) : 1106
Best Gene Model Blast : Link to GSTUMT00002911001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE58321.1| Score: 746 E_value: 4e-77
KEGG Definition: cyclin D-interacting protein GCIP
Accession: aor:AO090003001251 Score: 746 E_value: 2e-77
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, RNA processing and modification].
Kog Number: KOG2609 Score: 444 E_value: 1e-44
PFAM Definition: SYF2, SYF2 splicing factor. Proteins in this family are involved in cell cycle progression and pre-mRNA splicing..
Pfam Number: pfam08231 Score: 439 E_value: 4e-44
Swissprot: Q5BC69|SYF2_EMENI

Sequence:
>Contig1481
TTGGTCAAAATCGACAAAGAACGACGATTATATTTTTCTCAACTAGCTGT
TCACCTCTACGTCAAACAAACCTATAACTACACAACCACACAACTGCACC
CACAAATGCCCAAGAGGAAAGTGCCACCCACCGAAATGTCATCAGAATCG
ATCGCTCCCGGACCTCGTCACTCCAAACTCTCAGAGTCCGAATCCACCGA
CGCTTCAGACGCAGCGGCAACCCCAGAATCCTCCGATGCCGCTCAAAAAA
CTAAAGAGCGTGCCGAACGCTGGAATGCTCTAAAATGCCGTGCTAAAAAA
TCCGCCGAAGTAAACCGCAAAGAAGTCTACGCCGAGCGTCGCCGTCAAGC
CGTAGATCCTTCAGAAACCTCCCGGCTCAACCGCAAGCGCGACGAGGCGG
AATTCAAACTTGCCAAGGCCGAAGCAGAAGATGACGGGGAGGACTTTGAG
CGAAAGAGAGCGTGGGACTGGACCATTGAAGAGAGCGAACGTTGGGATAA
ACGCATGGAGAAGAAAAAGAAGCATGTTGAGGACGTTGCTTTCCAAGACT
ACACCCAGACCGCCCGCAAAATCTACAAGAAGCAGCTCCGCGAATTACAA
CCCGATCTCGAATCCTACGCCGCCGAGAAAGCAAAGTTAATCCGCGACGG
GACCATTGTCGAGACCGAGGATGGAGAATTGATCGCCGTGGATCGCGATG
GGGAGTTCTACGCCGACACCAACTCCCTTGGCTTCATTGATAACAAGCCC
AGCAAAGGCGCCGTCGATAGGTTAGTCGGCGACCTTAAGAAAGCCGAAGA
TGCCCGCATGCGCAGGCGCAAGGGCGGCGATGAGGAGGATGTGACCTACA
TCAATGATAAGAATAAGCAGTTTAATCAGAAGTTGGCGAGGTACTATAAT
AAGTATACTGGGGAGATTAGAGATAGCTTTGAGAGAGGTACTATGGTTTA
GAGATGGGTTGTTCGTGACATTGGCTTGGCTGGCGTAATGGTTGGAAATG
ACACATCGAGGGGCTAGTTAGCGGCAGTTTGTGCTCCCTTGTTGGTAGTG
TTTATTCTACAGATGTAGTCTACTAGTAGAAGTCTTAATTTAGTGGGTGA
TCTGCG

Sequences in the Contig:

SY0AAA52YG24FM1 SY0AAB7YA10FM1 SY0AAD46YG08FM1
SY0AAD52YM21FM1