Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1480
Length(NT) : 1009
Best Gene Model Blast : Link to GSTUMT00006006001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_01716
Accession: ref|XP_001792348.1| Score: 136 E_value: 2e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1480
TTGGATGGAAGAAAGGGAAGAGAGGAGGGAAGAAAATACCTTATTTCTTC
CCGAAGCAAAAAAAGATCACTTTTCCGGCCACTCGAATCATCACACGACC
ACGATAACTCATCAATAAACAAACCTGAATCTAGTCTGTCCTATCCTGAG
TTCACCACATCACACTGCTTTTTTATGCTCTCTTTTAGGGGGGAAAGTAA
AAAGAGAGAGACCGGAACAAGAATTGTGTTTGTCTCTTTTCGGAAAGTAA
CAACCCTCGAGAACTACGTTTTGTATGCGCACCCAACAGCCCGCCATGTC
GGTATCCAGCTCTATGGCCAGCTCTCCAGCTCCCTCCGATGCTGGCTTGG
GAGCTGCATCTCCGCCATCAAACTGCCTTTGCAATCGCAATCGCAACCAT
AACCAAAACCACGCCACCAAGGACAGGAATTCCTTCACCGATTCAATCAT
GGCAGCTTCAGTGAGGGAAAAGATGAAGCTCGCATCCCCATCACCGGCGT
CTCTTACCAGCTCCAGATACACATTTTATTCTCCCCGTGAGCTTCCACCA
CTCGAAATCACTTCACGTCTTCTCTCGGCTTTTATCCGCGGGACGAGCTC
CCTGATCTATGTTCTCGCTGAATATGAAGCTATGGAGCTCATCAGTGACA
TCTACACCCCCAATTTGGAGCCCAACACCCCCAAGCTTTGCGAACTTCTA
GCCATTATTGCCGTAGGTGCCCAGTATGAAGATGTTGGGAGCGATACCAC
CATGGCTCTATTCAGGAGTGCGAAATGGTACTTAGACATTGAGTGTGGGA
AGGATGTGGATGCGCTGAGGAAAATGAGAGTATCAATGCTTGTTGGGTTG
TTCCTAATCTTTGAAAAATCCTTCTTTGCCGTGGGTTATCTAGATCAAGC
GATTCGCTTAGCAAAATCCACTGGGGTTAATCGGACGACGAGGTGCAAAC
CCTACAGCGAACGAGAATGGGCTTCTTGGAGGAGGGTATGGAGGTCTCTG
ATATTTTTA

Sequences in the Contig:

SY0AAA10YO08FM1 SY0AAA52YG04FM1 SY0AAD50YN12FM1