Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig148
Length(NT) : 674
Best Gene Model Blast : Link to GSTUMT00004436001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64856.1| Score: 342 E_value: 1e-30
KEGG Definition: translation initiation factor 3, subunit c (eIF-3c); K03252 translation initiation factor eIF-3 subunit 8
Accession: aor:AO090011000340 Score: 342 E_value: 6e-31
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1076 Score: 307 E_value: 4e-29
PFAM Definition: eIF-3c_N, Eukaryotic translation initiation factor 3 subunit 8 N-terminus (eIF3c_N). The largest of the mammalian translation initiation factors, eIF3, consists of at least eight subunits ranging in mass from 35 to 170 kDa. eIF3 binds to the 40 S ribosome in an early step of translation initiation and promotes the binding of methionyl-tRNAi and mRNA..
Pfam Number: pfam05470 Score: 368 E_value: 4e-36
Swissprot: Q9XHM1|EIF3C_MEDTR

Sequence:
>Contig148
TTGGGTCTTTGTGAACAGGTGAAATACTATCAAGACAAGCTCCCCAACCA
CAACTACAACCGCAACCACACTCAGACCCCACATCCTTCGTCGATATAGG
AATCTCCCTGGACTGCGGATCACCCACCCACCATCGTTGAGATTCAACAA
TCATGTCTCGGTTCTTTCACGGGGGTCTAAGTGACAGCGATACAACCTCC
TCTGATGAGGACCTGTACTCAGAAGAGGAGGAGGAGGAGGAGGCTAGCGC
CGACGAGTCCGGTTCCGAAGACGAGTCGGACGAAGCCGACAAAGATGACG
ATGATGATGCGGGGCTAAAATTCTTGTCTCGCGGGGGAGGGGGTGATGAT
AGCAGTGATGAGGAGGATGGCAAACGAGTCGTCAAGAGTGCAAAGGACAA
ACGTGTGGAGGAAATCGAGGGCTCTATCAAGCTCATTGAAAATGGGGAGA
AGATCAATGACTGGGTGGTTATATCTGTAGAATTCGATAAGCTCAACAAA
ATCATATTAAAGAGTCCTGAGATACCGGGGGTTTACATCAAAGCTATTGC
CGACCTGGAGGATTTCATGAATGAGACCCTCAAGGATAAGGCTACGGCCA
AGAGGATGAACGCTACCAATGCTCGTGCTCTGAATACGATCAAGCAACGT
GTAAAGCGTAATAACCGTTCGTAT

Sequences in the Contig:

SY0AAA11YK14FM1 SY0AAA15YH02FM1 SY0AAA32YK19FM1