Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1479
Length(NT) : 1044
Best Gene Model Blast : Link to GSTUMT00012221001 E-value : 5e-39
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1479
TCGAGTACACCCGATCAAGCAATTGAACCACACCAAAAGGCAGTATGAGA
TCATCCCGCTGAGCAAATATCAAGCACCACCAACTACCGCCACTTCGACA
TTCCGGTTGAGAAAGCCTTCAGATGAAATAGGAACCAAGTCTTCCGCTCC
AAGTCACCCCTCCCATTGCCTAAATGCTACCTCTGCGGTCTTTTAATAGC
ATAGGTGGCCCTGATACCATGGCCCTCCCACGCCCCGACCATCCACGCAT
GGGTCTCCTAGTTAATTGAGTATCATGTCTGCAGAGTGGGAAGGTCGCTC
GGAATCACCCAGCCCCGGGGGTTTACTGTAATCACTGAGTAGTGAGGCAT
GGTGAGAAGTTTCAAGTTTGTAAAGGAGAATAGGGGGGCGTGTGTGGGTG
CGAGGTTTTTCTTGAATAAACTAACTGACGGGTACCATAGCTCTTTCGTC
GTAAACTGTGATCCAGGAGTCAGGGTACCGGTATTATCACAACGTTTATG
GGATAGCAATCGAGAAGTAAAGGGGAAAAGGGAGAGTTAAGGAAGGGCAG
ACGAGTGAAAGGGCACGATGGTGAAATGGAGGGGGTGGATGTTTGGATCG
TATAATACAGTACGACTGAATCCGCCTCATTTGACTATCGCAGCTTATCC
CAAGATCTCCCCAACCAGGACCTCGCCGCAAAAGCGGCAGCACCGAGGCA
CCCCGCATCCCTCCCTCTCGCAGCATAGATATCCATCCTCCACTCTGTCT
GCCTGCCCCCCCGCTTGCTGCATAAGAGGAAGAGGTATCCAACTGTATGC
ACCATATGTAACGTCTGTGGCTCGCTCCGCTACCGACGCTTCGGAACCCC
CTAGAACAGACGAAATCCAATTATCTCTCCCCTTTCCTCCAGCTTGACCT
CACCCCGCACCAGCCAACCAAGAAGAACTTTTTTATTTTTTCTTCCATTT
CAAACCCACTCTAGCGCATCACCCTCATAACCTACAATGGAAAGCTAAAA
CACGCGCAAACTAGATAACTCACACATACACCTTCAACCTTGTC

Sequences in the Contig:

SY0AAA52YG01FM1 SY0AAC16YH01FM1 SY0AAC5YM22FM1
SY0AAD21YJ04FM1