Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1478
Length(NT) : 1382
Best Gene Model Blast : Link to GSTUMT00007875001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein SS1G_08964
Accession: ref|XP_001590200.1| Score: 1088 E_value: 1e-116
KEGG Definition: hypothetical protein
Accession: ncr:NCU06207.1 Score: 1053 E_value: 1e-113
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0872 Score: 912 E_value: 8e-99
PFAM Definition: FA_hydroxylase, Fatty acid hydroxylase superfamily. This superfamily includes fatty acid and carotene hydroxylases and sterol desaturases. Beta-carotene hydroxylase is involved in zeaxanthin synthesis by hydroxylating beta-carotene, but the enzyme may be involved in other pathways. This family includes C-5 sterol desaturase and C-4 sterol methyl oxidase. Members of this family are involved in cholesterol biosynthesis and biosynthesis a plant cuticular wax. These enzymes contain two copies of a HXHH motif. Members of this family are integral membrane proteins..
Pfam Number: pfam04116 Score: 267 E_value: 4e-24
Swissprot: Q8J207|ERG3_LEPMC
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig1478
TAATTGGGAGATTTGTGACAATTTCACTCTCTTTAAAGCTCACGGACTTC
CTTCCTTCTATTCCCTTGTCTCTTTCCTTTGGCTGTCGGAGCAACAACGC
TTTCTTCTTCACCACCTGTTTACTCATTTATTCATTTGCCTGATTCACGC
TCGCTCCCGCTGGTGCCTGACGGCAGGTTCGACGATGGATTACATTCTTG
GCGTCGCGGATAACCTCTTCTTTGATGCTATCTATGCTACCCTTTTGCCC
GCCGGTTCGCTTGCAAGTTGGGCCGGTGCCAATGATACATTGACGGAGGA
GTATATGAATCCTCCGATAATTGTTGACGACCCTATCTCTCACTTCTTCG
GATTGAGGCCATCTCATCGAGCTTACGAATCCCTGTTCCTGAGAGGGGAT
TGGCAACGACAGGCCTTCTCGTTGTTTCTCATCACTTGGATCTTCGGTCT
TGTTGTTTACCTTGTTTTTGCCTCACTGTCGTACTTTCTCATCTTCGACA
AGGATACCTTCAAGCACCCCAAATTTCTCAAAAACCAGATTCGACAGGAG
ATGGCCCAAACGATACGCTCATTGCCTATCATGGCTATTTTTACGACCCC
TTTCTTCTTGGCTGAGGTTCGTGGCTACTCGAAACTATACGCAGATGTTG
AGCTCCATGGAAAGTGGTATTTGTGGTTCCAGTTCCCGCTGTTTTTGATG
TTTACCGATTTCTGGATTTACCTCATCCACCGCGGACTTCACCACAAGAG
TATCTACAAGACCATTCACAAGCCCCATCACAAATGGATCATGCCTACTC
CATTTGCCAGTCACGCGTTCCACCCAATTGATGGATTTTCCCAGAGTATC
CCGTACCATGTTTTCCCCTTTATTTTCCCGCTTCACAAGTTCGCCTACAT
CGGCCTTTTCATCTTCATTAACGTCTGGACTATCATGATTCACGACGGAG
AGTATGTTGCAAACTCCCCTATTGTTAACGGTGCCGCATGCCACACCATG
CATCACTTATACTTCAACTACAACTATGGCCAATACACCACTCTCTGGGA
TCGCCTCCTTGGCTCTTACCGCAAGCCCAACATGGAACTTTTCTACAGGG
AAACTAAGATGGGCAAGGATGAGTGGGAGAAGCAAGTCAAGGAGATGGAA
AAGGTTGTGAAAGAGGTTGAAGGAGATGATACCTTCAGAGAGTATGCTGT
CGATGTTTCTCACAAGAAGACTAAATGATTGTGATATCATTGTTTCGAGT
CTGATGTATATGTGGCGCCCCGTGGTTCTATTTTTATTTCTCTTTTTAGA
TTAGATGGTGGTGAAACCAGTGGGAAGTCAAAGTATTATATCCTTGATTT
TCTATGTTTTGTTTCGATTTCTTTTGTTCATT

Sequences in the Contig:

SY0AAA22YI24FM1 SY0AAA28YO09FM1 SY0AAA48YG01FM1
SY0AAA52YF17FM1 SY0AAA55YG09FM1 SY0AAB14YC08FM1
SY0AAB18YM14FM1 SY0AAB35YJ24FM1 SY0AAB3YH24FM1
SY0AAB45YB07FM1