Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1477
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00010801001 E-value : 2e-73
Numbers of ESTs : 2

Blast Results:

Nr Definition: DUF866 domain protein
Accession: ref|XP_001275834.1| Score: 144 E_value: 8e-08
KEGG Definition: DUF866 domain protein
Accession: afm:AFUA_2G15510 Score: 139 E_value: 2e-07
KOG Definition: No Hit Found
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 107 E_value: 5e-06

Sequence:
>Contig1477
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCCGAGTGGGTTGCCGACG
GGGTTAGCGGGATTGTGTTTGAGGGGGTGGATCTGGCCGAGGATTGGTAT
GATTATGATGAGAAGGCGGGCGAGGAGGTTTCGGTTAAGGAGGTTGGGTG
GGTTATTCGGAGGGCTTAGTGAGGGTTTTATATTCTGTGGAATGTGTTTT
TCGTTTTTGGTGGTGGCGGGTTGGAGGTCACGGGGGTTTAGGTTTGAGAT
TGTGTCATCTGGTGTCACTCGTGGTTTACGGGCTTTGGGGAGGGGACGGC
TGAAGGAGTGGTTCAGCCTGGTGGAAAGGCACATTTATTAGAGAGGTATC
TGCGGACTTTACTGTGGGGAAACACTGTTACGTCCCCAAGGTGTAAAGAC
ACCTTGTGCAGGCTACGCAAGATATGCACCGCAGCGCGTGTTAGTAACAC
CGCCTGACCCTAACCTGATCACTCGGATTGAATCACGCTTTGCGTTCCAT
CCGCCTCCAAACTCAAACCCACTAGCAGAGCATTGACCTCACTCCCTACA
ATGCGCTCTCTAGACCATGCATC

Sequences in the Contig:

SY0AAA52YF07FM1 SY0AAA52YF09FM1