Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1476
Length(NT) : 1862
Best Gene Model Blast : Link to GSTUMT00007236001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein SNOG_09800
Accession: ref|XP_001800087.1| Score: 434 E_value: 1e-40
KEGG Definition: hypothetical protein
Accession: ncr:NCU07834.1 Score: 420 E_value: 3e-39
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0049 Score: 121 E_value: 5e-07
PFAM Definition: No Hit Found

Sequence:
>Contig1476
TTGGCAGCAGGGACTCCTTCTTGTTCATGGCATAGACGTTGTTGAATCAT
GCACTCAAGTCTCTTGCACTCGCCGTTCCCACAAAGCAGCTTCTCCACAC
GAAGTACGAGTTTCGGTTCCGGGTCGACTGATCAATTACTATATTTCAAA
CTTAGCGAGGACAAGAACGCCAGAGTAAACGATTGAAGTCCTTCGACACG
GGGGGTGCCAAAGAAGATCGCGGGCCAGTCGACGGTACTTTGAGAGGATA
TATACTTATATATCGTACCACACCCCCGCGCATCCCAGCACCTATTTCCT
ATTTCCCTGGGCTATAGTTCCTCCACCCTGCAAACGTTATTTCCGATCCA
GCTTTGTCGTCAGTGGTTCCTGTGCCTTACTTGCTGCTTCCTGCTGCTCC
CTGACTGTACATTGGACCGGAACACGTCTGCCGCCAAACAAACACAACGT
CCATCCTTTGTACACATCAGTACCCAAAGAAAGAGAGAAAGAATATCAAT
AGAAGTCGTGTTCGAGACTCCTATAATCCTTTACTTTCCAACACAGTGGC
TGCTCCATATCAGCTCGACGAGTATCCGCGCTATACCCATCGCCATTACC
ACCACCACCATCACCACCCTCAATCGCCTTATATTCAACAGGAACACGAG
CCTCGGGGTCTCGATTCCCTCGAAGATCTGAACGAGCCGCTGCTTCTAGT
ACAGCAGATGGCTCATCAAAGGCCCCCGCCACACATGGGCGGGGCAGGAG
GTAGTGGGCACCTTTACGGTCCGGGACTATCTTCGTCCAGCAAGCCAAGA
GCGAGAACTCATGATGAAATAGAAATCGATCTTAGTGACGACCAAGATGT
AGATTCTCACTACCAGCATCAACACCTTCCCCCCCCATCGCATCACCATC
AACACCCACAGCACACCCATCATCACCACATGCCAGATCAGCCACCACCC
GCAAAGATGGCGCGAACAACTTCGGTGATGGGCGTGGGGGGAGGTTCGCA
GATGGGAGGTTCGTCAATGGGTATGCCGGGACCATCATCACTCGCTGGGC
CATCGAGCTCGCAGCAGATGCCAGCGCCGGCACCAAGACCACGGGGCCCG
AAGCTCAAGTTTACACCTGAGGATGACCAGCTGCTTGTCGACCTGAAGGA
GAACAAGGCACTGACTTGGAAACAAATCGCCGAATTCTTCCCTGGTCGCT
CATCAGGCACTTTGCAAGTCCGTTATTGCACAAAACTGAAAGCCAAGACC
ACGCAGTGGACAGACGAGACTGTGTTACGGCTCCGTAATGCTATCCAGGA
ATACGATCAAGATCGTTGGCGTCTTATCGCTGCCAAAGTTGGAAATGGCT
TTTCCCCAGCCGCTTGCAGAGAAAAAGCAAAGGAGCTGCAGGAGCCGTAG
GTTCCGAAACAATCACTCGCAGCAACGAGGTCTTACGCCACCAGATCATT
CTTCTCGTTTTTCTGCGACTGCTGGTGACTTTTTGACGTTGTCTAGAGCT
GAAACATTCGGGATTCAATTCTGCTTCATTATTTCGGGATTCATTCTATT
CTTGACTTGGTTCGATTTTTTGGTTATTTCTTTTATAATAATATTTTTGT
TACGGGAGCGAAAGAGGTGGTAAGAAAAAAGCCTTGAACGTGGGTTGGGC
AGGGCCGGGCAACAAGCGCAGCATTATACTTTGATTCAGATTCGGGAGGG
GATAGGGGGTTGGTTTTTTTCGGATTTGTGGGGGCAATATCGGCGTTCTT
TTCTTTTTTCCTCTTACTTCCCTCGTTCGTTCAGTTGGATTAATTTTTCG
GCATTACCCTCACTGCCTCTCATCCATCTTTCATTTTGCTGTGCTCTTTG
TCTCCCTTCAGT

Sequences in the Contig:

SY0AAA14YM13FM1 SY0AAA15YP07FM1 SY0AAA26YB23FM1
SY0AAA29YB07FM1 SY0AAA43YN03FM1 SY0AAA52YF03FM1
SY0AAB27YN14FM1 SY0AAB31YA17FM1 SY0AAB57YK17FM1
SY0AAB8YC15FM1 SY0AAC55YN04FM2 SY0AAD36YP03FM1
SY0AAD46YF10FM1