Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1475
Length(NT) : 706
Best Gene Model Blast : Link to GSTUMT00005863001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE60847.1| Score: 344 E_value: 8e-31
KEGG Definition: predicted protein
Accession: aor:AO090012000717 Score: 344 E_value: 4e-31
KOG Definition: No Hit Found
PFAM Definition: DASH_Ask1, DASH complex subunit Ask1. The DASH complex is a ~10 subunit microtubule-binding complex that is transferred to the kinetochore prior to mitosis. In Saccharomyces cerevisiae DASH forms both rings and spiral structures on microtubules in vitro. Components of the DASH complex, including Dam1, Duo1, Spc34, Dad1 and Ask1, are essential and connect the centromere to the plus end of spindle microtubules..
Pfam Number: pfam08655 Score: 275 E_value: 2e-25
Swissprot: Q9P6S5|ASK1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0042729 = Cellular component: DASH complex
GO:0005816 = Cellular component: spindle pole body
GO:0045132 = Biological process: meiotic chromosome segregation
GO:0008104 = Biological process: protein localization
GO:0031134 = Biological process: sister chromatid biorientation
GO:0030437 = Biological process: ascospore formation

Sequence:
>Contig1475
TTGGATCATGATACGATAGCCTAACAAAGAACAACAAAAAAAACAATATT
AAGGGAAGGAAGATGTCGAGACCGCCGCTGAGCTTGACGGCAGAATTGGA
AAAGTTGGAGCAGAGTATTACGCTTACCTTGCAAGAAATTGATCACAACT
TCAGTAAAGCCCATCGGATTGTCACGACCAGTATCATCCCTATTGTTGAG
CGATACGCGAAGGAGTCTGAGGCTGTTTGGGAGGGGTCGAAGTTCTGGAA
GCAATTCTTCGAAGCCAGTGCTAACGTCGCACTATCAAACTACCAAGAGG
AAGAGGAGACATATGAAGAAACCGGCGTGGCTACCAATGCAGAAACGTAT
ATAACTGCCTCTTCGCCAGGAAATTACGGCGAGCAGTCCACACGGATAAC
GCAGGAAGACGACCCCCGACACCGCGGTCCCGAAGAGGACGACGATGACT
ACCTACTGGATGATTCACTATTAGAGTCGCTAAATTTGACAGCGGGAGGA
TTGGGTGGAGCAAGCACGCCCAAGGGGAAGCAACTCCAACGCACAGAGAC
ACAGTGGGAGAACATCGAATCACCTTTCGATGCGCTGCGCAAGGAGTTGG
CCGGGAATGACTATACTATGCACGGCTCTCCCACCACCGCCAATACCGCT
GCCGCTCCTGCCGCCGGCGCAACCGGCTGCGAAGACTCCTTCGGCAGCGA
CGACGC

Sequences in the Contig:

SY0AAA52YE17FM1 SY0AAD4YF07FM1