Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1474
Length(NT) : 833
Best Gene Model Blast : Link to GSTUMT00007973001 E-value : 1e-176
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 161 E_value: 5e-12
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 131 E_value: 2e-08

Sequence:
>Contig1474
TTGGTTTTCTCCCCTTCCCCCTTCTCACTGTTCCTATAAAAGAGGGGCAG
TTCGGGGAGGGGGAAAGAGAAAAAAATCCAGCAATCCTCTGTTCGCTCGC
CAACTTTGAACCAAATCGATCTTAAGGGAGAGGAAAGGGGTGAGCGAGAG
GGAAAAAAAAAAAAAAAAAAAAAATCACCCTAAGCTAAACTCTTCCAATC
GATTCCGCACCCTTCAAACTAAGCGGGCCGGATATGCAAAAATCAGGCCG
AGGCGGAAGGGGGGGCTCTGGGAGCGAACCGACAGAAATTATTTCCGAAG
CCTGGAAAAATCCAATCAAAGAACTACGCCCTGCCCCCAAAACCGCATCG
ACCGAAGGCTGGGAAGTCCCTCCTCCACGGACTTATCCAACTCCCTTCTG
GGTGGAACAACTCAAGATTGTGCTCCCAGAATGGATGTTCGACACTCTGG
GGAACCTCCTAGACGACCTGAGGTTCGACGATCACGGTTATGGCTACACT
TGTGATATTTACGAAGTATTCTGGGACGGAAGCCAGTCTACAGCACCACG
ATCTGGCGGCTTCTCCGGATTCGGTGGCGGTGGTGGAGGCGGAGGTGGAG
GGGGTGGAGTCTGTCGATCTTATCAAAATACGGGCACCTGTTCTTTCGGC
GACAGGTGTAGGTTCAGTCACGATAACGATGGCCAACGACAATTCGTACT
TCCCGAACGCCCTAGAGGTGGTGGTGGTGGCCGTGGCGGTGGCCGTGGGG
ATGGTGGTGGTCGTGGAGGTCGTGGACGTGGTGGCCGTGGCGGTGGGGGT
ATATGTAAATTCTACAATACTCCCCAGGGCTGC

Sequences in the Contig:

SY0AAA24YI11FM2 SY0AAA31YC08FM1 SY0AAA44YK11FM1
SY0AAA47YE18FM1 SY0AAA52YE11FM1 SY0AAB19YC15FM1
SY0AAB44YN13FM1 SY0AAD10YC09FM1