Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1473
Length(NT) : 834
Best Gene Model Blast : Link to GSTUMT00004033001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 128 E_value: 3e-08
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 114 E_value: 1e-06

Sequence:
>Contig1473
TTGGTCTCTCTCACCCGTTTGTCATCTACCGGTAATAGCCTGGTAACAAC
ACTGGGCAAACTGATCGGAGAGAACCCGTGATGCAATCCCTGCAATCTAT
TCCACCTGCCACCAACGATCGACAACCGTCGAATCACAAGCCACTACCAG
AATCCAGCAGTCGAATCTCATCCCCACTTGCGGAGAGCTCTGAGACTCTG
CTCCCTTTGTCTCGTCCAAAATTCTTTTTTCCCTTCCAAAACTGTTGTCA
AAAATCGTTTCCCAACAGCTACGATCAACAAGTAAACCTCCCCAGGAGTT
CCTCAGTCACTCCCGCACCCGTCGAAACCCCGATTGGACCTTTCAAAAAC
GAACGGTATGGACTCAGAATTATTGGCCCACCAAGCACGAGCGGCGGTAG
ATACCCTCACCGCACAACTCCGCTCCCTAGAGAACGAGCAAACAGCGCTC
TTGCACTCGCTGCAATTAACCTCCACAACGCTTTCCACCCTACCCGCTTA
CAACTCTATCGCTCCAACCTTCTCTCAGATCCCCTTGTACGAGTCGAAAT
TGGCCCGTCTCAAGAGCGCAATGGCGGCGCAAGCGCAGGAGGTCGACGAG
TTGAAGCGGCGGGCGAGGGAGGCCAATGAGCGCCGGCGGAGGAACCTCAA
ACGGATCGAGGAGGCGAGGAGGGGGGAGCGGGAGCGGGACAGGACGGTGC
TGAAGGCTCAGGCTCGGGCCGTGGAAGGTGAGGAGAATGGTAATAATAAG
GAGAGGGATGACGGAGAGGCTGTGGCGGAGGGGGAGGTCAAACGAGCAGG
TACGCCGGTGAGGGGACAACCAAGGGAAGGGGTT

Sequences in the Contig:

SY0AAA4YM02FM1 SY0AAA52YD09FM1