Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1472
Length(NT) : 639
Best Gene Model Blast : Link to GSTUMT00000964001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_07970
Accession: ref|XP_001798296.1| Score: 544 E_value: 4e-54
KEGG Definition: hypothetical protein
Accession: ncr:NCU04738.1 Score: 506 E_value: 5e-50
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG3056 Score: 381 E_value: 9e-38
PFAM Definition: zf-primase, Primase zinc finger. This zinc finger is found in Mcm10 proteins and DnaG-type primases..
Pfam Number: pfam09329 Score: 168 E_value: 5e-13
Swissprot: O42709|MCM10_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0000790 = Cellular component: nuclear chromatin
GO:0043596 = Cellular component: nuclear replication fork
GO:0005819 = Cellular component: spindle
GO:0003896 = Molecular function: DNA primase activity
GO:0005515 = Molecular function: protein binding
GO:0003697 = Molecular function: single-stranded DNA binding
GO:0006270 = Biological process: DNA replication initiation
GO:0006271 = Biological process: DNA strand elongation during DNA replication

Sequence:
>Contig1472
TTGGCCCGAAGACCCCGATTCCACAGACGAGGGTGGTTTCGACTCCTTCT
CAGGCCTGCACCTCTCCCGCCGTCTGATTACCCACGTCACCCTCTCCCGC
CACCTCTCTCCGAAAACCATCTTCCTCCTCTCACACCTCCTAAGATCCAT
CAAATCTCCCGACTTTGAACCACCCGACGTCCTTGGCGACTGGGTTGTGA
TGGGCATAATCTGTTCGAAATCCTCTCCAAGGGACGTCGGGCAGAACACC
CAAAAGAGGGGCACAGGGAAATACATGGTCCTCCAAATAACTGATCTAAA
ATGGGAGGTAGAGCTCTTCCTGTTCGGCGCGGGGTTCGATAATTTCTGGA
AGGTTGGCGTGGGCACTGTGGTTGCATTGCTTAATCCTGGCATACTGAAG
CCGAGGATCACGGATACAGGGCGGTTTTCACTTACTTTGACGGAAGGTGA
TCAATTACTGGAGATCGGCCAGGCCAGAGATCTGGACTATTGCAAAACCG
TTAAGAGAGATGGGAAGAGATGTGCATCCTGGGTTGACAAGCGCCACACC
CACTATTGCACCTTCCATGTCGAACAAGCCCTGAACAAATCCCGTGTATC
CCGTGCAGAGGTAAATTCAACTACGAGAATGTTCTCCCC

Sequences in the Contig:

SY0AAA52YD05FM1 SY0AAA58YH18FM1