Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1471
Length(NT) : 1062
Best Gene Model Blast : Link to GSTUMT00006218001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU06877
Accession: ref|XP_959224.2| Score: 842 E_value: 3e-88
KEGG Definition: hypothetical protein
Accession: ncr:NCU06877.1 Score: 842 E_value: 1e-88
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1470 Score: 592 E_value: 8e-62
PFAM Definition: CRAL_TRIO, CRAL/TRIO domain. The original profile has been extended to include the carboxyl domain from the known structure of Sec14..
Pfam Number: pfam00650 Score: 379 E_value: 3e-37
Swissprot: Q10138|YAS2_SCHPO

Sequence:
>Contig1471
TTGGCGGAGCAGCAGCGGAGAAGGATAATGACTTTATGATGCAGTTGCGT
ATGGGAAAGTGTTATCTCCATGGACTGGACAAAGAAGGCCGCCCTATATG
TTTTGTCCGAGTGAGACTGCATAAGCAGGGTGAGCAGAGTGAGGAGAGCC
TTGAACGGTACACAGTCTACATCATGGAGACGGCCAGGCTGATGTTGCAG
CCTCCGGTTGACACTGCTGCGGTTGTCTTTGATATGACTGGGTTTTCTAT
GGCGAACATGGATTACGCCCCTGTAAAATACCTGATCAAATGCTTCGAAG
CTCACTACCCCGAGAGTCTCGGAATCTGCCTCGTACATAAAGCCCCATGG
TTGTTCTCAAGCATCTGGGCCGTAATCAAAGGCTGGCTCGACCCCGTCGT
CGCCTCCAAAATCCACTTTACCAAAACAATCGAAGACATGGAAGCCTTCA
TCCCTAAAGAAAACATCCCCAGAGAACTGGGCGGCAGCGAGGACTGGACC
TACACATACGTAGAGCCAACCCCCGACGAGAATGTCCCGCTGGAAGACGA
GGCACGCAAAAACACGCTCCAATCCGCCCGCGGGGAGCTAGTCCGTAAAT
ACGAGAGCGCGACGCACGCGTGGATTGCCGGCGGCGAAGCGGGTGAGATT
GCTGCTGCGGAGCGTAAAGCTATCGCTAGGAAGCTAGCCACCGGGTACTG
GGAGATGGATAAAAACTTGCGCGCTAGGACGGTTTATGATCGTACCGGTG
TGCTGTTGCCGAATGGTCAGGTGGACTTTTATGGTCATAGAAAGAAAAAC
GCTGGTGCGGTGGAGACTTCGGAGGATGACATTGATTAGTTTGATTTTTG
TGATGGTTTTTATTTTATTTCATCTTTCTCTTGTTTGGAGGAGGAGGAGG
AGGAAGGGTGAGGGTAATGGTTTTTGAAAGTTTTTGAGTATGATATGATA
GGCTAGATACCATGATCTGCGGGGTTGGAGGTGGGAGTTGGGATGGGATG
AGGTGGCTTTAGATAGGTTTTTTTTTTTTTTTTGGTTTGTTTAGAGGGCT
TATCGTACTTCT

Sequences in the Contig:

SY0AAA52YC23FM1 SY0AAB47YC11FM1 SY0AAB50YD07FM1