Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1470
Length(NT) : 1117
Best Gene Model Blast : Link to GSTUMT00003529001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: unnamed protein product
Accession: emb|CAD60617.1| Score: 229 E_value: 4e-17
KEGG Definition: hypothetical protein
Accession: ani:AN3838.2 Score: 227 E_value: 3e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1470
TTGGATTGTCAGACCTCCAATAACTTCATTGACACTCCATCAGCACATTT
TCTAGAATAGCTTTTGCCAAGCACTCCCAGATAAGCCAAAATGGGCCAAG
CACATTCTTCCAAACAGCCCGCTCAACCTTCCGCAGAGGAACTCTCCCGC
TGCCTTGCACAGCGCTTTGCCGACCAGAGCTTCAGCGGCGTAGAGCTCTA
CTCGTTCAAGGACAACTTCCGTACGCTAGCGGACGTGCATAAGTCTAAGA
CCAGCCGCGCCGGGCTCTTGTACTGGAGCGAGGATACTCTGATCAAGTTC
CTGGCAATCCCGGACTGCCTAGAGGTGGGAGCGATACTGTTCTGTGCCGC
GTCTTATATCGGGGCGTTCCCGTTTCCGAGTCTCGCCCCAGTAGTGCTAG
ACTTTGAGGCGTTGGTGAAGGTCTTTAGCGGTTTATGATCGGGGGGTTCA
CCAGGAGGGAGGGGGTAATGGTGGGATGGGGAAGGAGAAAGGGAACGAGG
TAGACGTGGACGTTTCGTTAGAGGACAAAGAGGGCGAAGGGGGTGAAGAT
GAAGATGAAGATGACCTTTCGCTTGCCGCTTTGGACGCGCTGGACGCAAT
TGAAGCTTTTGGGCATGCTGAGAAGTTGAATATTCACCATGCACGTATTC
CACTGGATATCATGAGGAAATTGATTGCTTTCTTACTAGCGATTGCTCCC
CTGAGGCCTAGCCAGCCCGTAGCAGATTTCTCGGATAGACTTACACCTGA
TGCTCTCACGGGGGTGCGTGGTGTTGGAGAGTGCATTCTCCGAGGGTTCA
GGTGCAAAGATGAGAAAGGGGTGCTATATAGCGACTTTAAACCAACGATC
AAGAAATCATTGGTTTGCTTCCTATTGCATTATTCTAACTGCTCGCGGTT
ACGAAATCTAACCCGCATAGCCATACATGTTCACTCCACTAGAACCCCTC
TTCGAGCACCTCCTCTTCAGCAAAAATGTCGACATGTCTATAGCCACACC
CTCCAATAACTCTGGGCCACCAATTCCGCTACTCTCCACCGAATGCCAAA
TAATGGACCTCAATCTCCTCGGCCAAATCTCTTTCTTCATCCCCGGCACC
CACCTCTGGCATCGACT

Sequences in the Contig:

SY0AAA52YC10FM1 SY0AAA57YC08FM1 SY0AAA58YC08FM1
SY0AAA7YF04FM1 SY0AAC11YL10FM1 SY0AAC12YD01FM1
SY0AAD35YG12FM1