Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig147
Length(NT) : 506
Best Gene Model Blast : Link to GSTUMT00004016001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001588182.1| Score: 291 E_value: 5e-25
KEGG Definition: hypothetical protein
Accession: ncr:NCU08954.1 Score: 229 E_value: 4e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig147
TTGGGTCAGATTCCCTGCTACTACCACGAATTTCACACAAGGGCCTCATA
ATTTCCTGAACAACTACAAGTACGCTGCAGCAATGTCCACCTCACCACAA
AAAACGGAATGGCTCTGCATCTTGCCGGACCAGGTTAACGGCGGGCTGGA
GAGGAGACTTAAAGTTCGCACGGAACATCTCGAGGGTATCAAAAGGAACC
AAGAAGCCGGATTCGCCAACTTTGGCGGAGTGTTCCTCAACGAACCCGCG
CAGGAAGGGAAGGATCTCTCCTTCAGGGGATCTATCATTGTCGCTACAGG
AGTGAGTAAAGAGGCCGTCCTCGAGGTCCTGAAGCAGGATGTTTACTCCA
AGAATGATGTGTGGGATTGGGAAAAGGCCGAGATCTATCCCTTCAAAACT
GCAATTGCATCCCCACTTCCGTACGTTTAGGTTAGATAGCGATGGATGGG
GGTGACTTGTCGTGAAGATTACTATTTTAATAAACATTTAAATACCTCCT
CCGAAA

Sequences in the Contig:

SY0AAA15YG23FM1 SY0AAA26YH06RM1 SY0AAA46YA06FM1
SY0AAA48YB16FM1 SY0AAB38YD05FM1 SY0AAB38YH17FM1
SY0AAB41YC05FM1 SY0AAB43YG19FM1 SY0AAB44YP06FM1
SY0AAB48YP05FM1 SY0AAB50YL08FM1 SY0AAB53YH10FM1
SY0AAB53YP24FM1 SY0AAB59YJ21FM1 SY0AAB60YM13FM1
SY0AAB9YL10FM1