Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1469
Length(NT) : 987
Best Gene Model Blast : Link to GSTUMT00002511001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_14406
Accession: ref|XP_001584637.1| Score: 221 E_value: 3e-16
KEGG Definition: hypothetical protein
Accession: ang:An16g04030 Score: 145 E_value: 2e-16
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 153 E_value: 5e-11
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 120 E_value: 3e-07

Sequence:
>Contig1469
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCACGGGTACCAAAACTTAAG
CTCACGTTCTGCTGAACCACCGCCCTTACTTACCAAGCTATAGACACAAT
GGATGGCCCCCGCCGCCCCCATCGCTCACACCGCTCACACCGCCCTAGAG
ATCACTCCCACTCACCGCACCACTATTCCCGCCACCACCGCCACCACGAC
CGTAACTCCCGCTCAAGTTCTCAATCCCGAGACCACCATTCCCGTGAACG
TCATTCTCGAAACCACCACCGCCACCACCGCCATCATAAGCGCACCCGTT
CTCCCTCGCCAACCATAGTTCGCCCTTTAAACGCCCCGCGAATCTCTCGA
CATGATTTCGAGTTTCATAGGGATGTGTTTGCAGACTACCTTGACATTCA
GAAAGGGTTGACACTCAGTGAGCTGGACAGGGCCGAGGCGAAGGGACGGT
TCAAGAGATTTGTGACGCACTACGAGAGGGTGGTATGATCGGATAGTTAA
TAGGAAGGCCAGCGATTCAACGAAGGCTCCTGAGGAACAAAGGAGCAACT
CTAAAAAAGATGAAGATTCTACTTGGCCGGAGAAGAAGAGGCGGAGAATG
GACACTCCTCGGTCCGACAAAAAAGGCGAAAGTGAGGAAGAGAATGAAAG
TGAGAACGGAGAAACTAGCGAAGAAGAAATCGTAGGACCATTACTCCCAG
GCCAACAACCCTCAAAGCGATCCCGCGCACGGGGCCCTACAATCCCTTCA
ATAGAAGATCTCGACCTCCAGAAAGAACTCCTCCGCGAGGACCAAACCCT
CCAACACCTTAACCTCCGCCATGCCCGCAAGCAAGAGCGCAAACTCGAAA
AGGAGCGCCTAGAAGAACTCGTCCCCCGCGCGGCCCCTGGCACGCACGAA
CGCCAACTCGAGAAGAAAGCCGAGCTCAACGCCAAGATGAAATCCTTCCT
CGAGAAGTCTCCGGATCTGGAAGTCAATGAGGAAACT

Sequences in the Contig:

SY0AAA52YC02FM1 SY0AAC35YB21FM1 SY0AAC62YN23FM1