Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1468
Length(NT) : 831
Best Gene Model Blast : Link to GSTUMT00001494001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215590.1| Score: 391 E_value: 4e-36
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 379 E_value: 5e-35
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig1468
TTGGCTCTTCCAATTTAGGGATCCATTGATAATATGGGCAATCTACTATC
AAACGTGCGCTCCTCGCACCAAGCGTATGCTCTTTTCTTTGTGGATATTA
GTGCTTCCAACCATTAATGTCGGTGGCTACGGCTCTAGCTCTATGGCCAA
TGGCTATATTCGTAGCGGCAACTCCGGTTCCTATGACATCTACTCTGGCG
GTGACGCGAACTCGTCCCCGAGCGATGCCGAAATTTTGCAATGCCTCTAC
ACGTCTAGATACGAGGAGCACCGAAGTCGTGTTCGGGAGCCGGTCGAGGG
AACATGCTCCTGGGTTGTTGACCATCCAAGGTATAAGGACTGGTTGAATG
AAAAGGCACTCAGTCTCCTCTGGCTGTCCGGGGACCCGGGTTGCGGAAAG
TCTGTCACGTCTTCGTTCCTTGTGGAGCGTTTGAAAAGCCGACCGAATTC
CATCGTTTGTTATTTTTTTTTCAAAGATGACAACAATGAACAGAACAACG
CGGCAATTGCTCTTTGCGCCATACTACATCAGATTTTTATGCAGAGAAAG
CACTTCATTGGATTCGCAAAGGAAGGGTTTAAGGCTAAAGGTAGCAAGCT
TACCCAGGAGGTTGATGCGTTGTGGAATATTTTGGTTAGGGCGGTAGCTG
GGGGGGGGTGCGGCGATGTGATTTGTATTCTGGACGGCTTGGACGAGTGT
GAAGAAAGCACTCGAGCTCGACTCATCCGTCTTGTGGCCGGCCTAACTAG
GTCGCAAAATTTCGAGATACCGTTGAAACTACTTGTTACGAGTCGCCCAT
ACCACGATATCGAAAGAGGCCTTTGTTTACT

Sequences in the Contig:

SY0AAA52YB12FM1 SY0AAA63YN21FM1 SY0AAB27YI22FM1
SY0AAB34YK07FM1 SY0AAC34YN16FM1