Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1467
Length(NT) : 887
Best Gene Model Blast : Link to GSTUMT00000457001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_00846
Accession: ref|XP_001247075.1| Score: 384 E_value: 3e-35
KEGG Definition: ATP-dependent RNA helicase Mrh4, putative
Accession: afm:AFUA_2G08480 Score: 378 E_value: 7e-35
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0330 Score: 144 E_value: 5e-10
PFAM Definition: No Hit Found
Swissprot: Q1E9B7|MRH4_COCIM

Sequence:
>Contig1467
TTGGAGCAACAACATCAACAATGATCCGAAATCGACCTGCATGTCTGCTG
TGCCTCCATGGACTCGGTGCTCTTTCCGCTCCTAAATTCTCTCCCCCGAC
ATTTTCACGATGTGTGGCTAGCGCTTCATTAAGAAGGCGTCCTTCCCGCT
TTACTCTTTCTGACCGGGTTGCCGAGAGGCCCGTCGAGAGCAAGCGGAAA
CCAGAGCCAACACATGGAATGAACCGAACAAAAGTTAATATCCCCCAACC
GGTGTGGAGGAATAGACGGCCTTGGTCCAAGGTGCGCGATCAGGTTGAGG
GACGGTTCCAAAAAAATGAAAAACTTGACCCTAAACATATGAGAATGGCA
CAATCCCTTGGTGTCGTTTCAAGAGCGCAAAGAGACGAGGTCAAGACTGA
GGTTGACAAGTGGTTTTCATTTGACAACTTTGATCTACTGCCGTCTATAA
AAGAAAGTATTATAAAAGGAGCTTTGAAGGGGTTAGATACCGTTGAACCC
TCTCCGGTTCAGAAGTTAGCCATTCCAGTGCTGACGGGCCAGACCACGAG
GCGGCATAAGCATGCAATTGATGACAAGAATCCTTATGAAGTCTTTCTTA
TTGCAGCCGAGACAGGTTCCGGAAAAACACTTTCATACGTTGCTCCCATT
CTTGATTTCCTCAAGCGGAGCGAGGAAGCTCCCCGAAAAAATGATGGAGC
AGAAACATGTGTGGAGAGAGTCCCTACCCCGAAGGCTCCCGTCAGAGATC
TATTCGACCTAGAAATACCCATCATGGAGCCAAAAGAGGACAAGGGGAAC
CACGGAAAACCTCGAGCAATAATCTTAGTTCCAACCTCCGAGCTCGTCAC
TCAAGTAGCAAGTGTAGTAAAGTCGATGTCCCACATC

Sequences in the Contig:

SY0AAA52YB07FM1 SY0AAD44YE19FM1