Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1466
Length(NT) : 808
Best Gene Model Blast : Link to GSTUMT00006123001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_00494
Accession: ref|XP_001598405.1| Score: 699 E_value: 7e-72
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06965 Score: 630 E_value: 4e-64
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P32843|RNA12_YEAST
Gene Ontology:
GO:0031305 = Cellular component: integral to mitochondrial inner membrane
GO:0000002 = Biological process: mitochondrial genome maintenance

Sequence:
>Contig1466
CTCAGAGAAAAGAAATTGAAGCCTTGGTTCTCGCCGTTCAAGCGGGTTAG
GGCATTCATTGTAAGGGGGAAACCGTGGTTAGAAGACTTGTATAGGTTTC
CGAGCACGAGGTTGAAGGTGGAGTTTATTGGTGGTGAGGGGAGTCTTAGC
CAGGAGGCTATATATGCACTTTTTAGGCGGTACGGGAGGATTATCGACAT
ACTCCCTCAACCGCCGGGATCGAAGGAATTACCAAAGTTTACGATTGTGC
AGTACCTCCGTACGCGTAGTGCTACTGCAGCAAGGAATTGTCTGCACGGG
TACACGATCCCAGGAACGGAGGCTGTTCTTGGAAAGGAGCCTGGTGTGAC
GTTAAGGGTTCTGTACGAGAGGGCTATCAAGACTAATTGGATAAAGGATT
GGCTGTTCAATCATCCGAGAATTGTGATCCCGCTGGTAGCAGCGTTCGTA
GCAACATTCACCGTCGCCATATTCGACCCTGTAAGGACTTGGTTCATCAA
AGCCAAGATCACCGGAGCCTTGAATATTAGCGATAACACATACTATAATT
GGTTGAAGAGACATACTATCGGGATGTTGCCTATCGGAGCCAAGCACACG
GACATGGATGATTTATGGGCGGTCTGGGATGAGCGCAAGGAACAAGTCGA
GCAATTAAAGGCATGGCTGTCAGAAACAGTGGAGACGTTCATCGTCGTGC
AGGGCCCCCGAGGGTCCGGGAAGAAGGACCTGGTGGTCGACACCGTGCTA
GCGCATAGGGAGAATGTCCTCATCATCGATTGTGAGCCCATCGATGAGAC
GCACGGGG

Sequences in the Contig:

SY0AAA26YH18FM1 SY0AAA52YA24FM1