Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1465
Length(NT) : 1159
Best Gene Model Blast : Link to GSTUMT00006187001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_08955
Accession: ref|XP_001590191.1| Score: 259 E_value: 1e-20
KEGG Definition: hypothetical protein
Accession: ncr:NCU08992.1 Score: 252 E_value: 4e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P38958|PT100_YEAST
Gene Ontology:
GO:0031305 = Cellular component: integral to mitochondrial inner membrane
GO:0051082 = Molecular function: unfolded protein binding
GO:0009060 = Biological process: aerobic respiration
GO:0008535 = Biological process: respiratory chain complex IV assembly

Sequence:
>Contig1465
TTGGAGCTCAAACGGTTGAACAGTGCATGACATTGCCGGAAATTAAGTGG
TGCGGGAACGACAAGGATAGCACGCCACGCTAGATCCAGTACGGTAGGCG
AATCAACTCCCCTAACCATCGATAAAGCAAGCCACCCCACCTGCCACCAC
CACCACCGAACCATCCAACCGTCGAACCGTCCGAAACATCCCAAAACCCT
CAACCCGACCAGCCAACACAACCCAAACATGGGCGGAAGCAATCTAGAAG
TATTCAAGTTCGGAATGTACATCATGTTCCCAATCGCAATCATGTACTAC
TTCGGCACAAACCTCGATAATCGCTTCTCCGTGCCAGGATTCTGGCCGAA
GCCGGAGGAAACGCACAAGATCCCCTTCGAGAGGGACGAGATAAAGGCGG
AATTGGAAAGGTTAAGGCGGAAGCGGTTGGAGAAGCGCGCTAGGCGGCTG
GAGGGGGAGCGGCACGAATAAGGGAGGAAGGAAAGTGGCGGGGTGTTCGA
TGGGGATCTGGGGTTTTTCTGGGCAGATTGGGCACTTTGTCTTTTCCCTC
TTTTCCTTTTTTTTTCTATTCCCGGTGTTTGCTGGAAAATTCTCTGTTGA
TAGTATAGTCCAAGTGTGTTTATACGTTCGCATGAGAGAGGACGAAGTTG
TGCTGCGGGAGATGGGCGGGGAACGGGTTTCCCGGGGGTGGATGGATGGC
CCTTGAATTTTCTGTGGCTGCCGTCCCGTAAGATGGGTCACTGACGAACA
CCTTTTAAAATTCCTCCTAAAACACACCTCACCTTATCACCCCCGCTTCT
CCCCGACAAACTGACAAAACAATTGGGCTAAAATGGAGACAACTTCTGTG
AAATCCAAGGCCAAAGAATTATACCCTAGCGATTATCCGGAATTAACGGC
CACTACTGCGAGAAATAGACCTCCCCGTAGTCCCTTCCCTCCATACCCCG
GGCGTCTCAAGCTCTCGGACCTTTCTGAGATTTCAGAGCTCTCCCGGTTC
TCCTGGCGCTCCAAGCCCTCTACTACTAAGATCTCTGGCGCCGGCACGAC
CGAGGTACCTTTTGGAATCCCCGAATCCCCGAATTTGCCGCCCACTCCTT
CTCGCTGTACATCCGCGGATGACGGCTTACATCTCGGTTTGTCCTGGGCC
GAAATGCCA

Sequences in the Contig:

SY0AAA52YA09FM1 SY0AAA60YC18FM1 SY0AAD61YL08FM1
SY0AAD6YJ20FM1