Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1464
Length(NT) : 1375
Best Gene Model Blast : Link to GSTUMT00009940001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein CIMG_04201
Accession: ref|XP_001244760.1| Score: 1046 E_value: 1e-111
KEGG Definition: hypothetical protein
Accession: ncr:NCU02701.1 Score: 1024 E_value: 1e-109
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3675 Score: 392 E_value: 1e-38
PFAM Definition: Peptidase_M49, Peptidase family M49..
Pfam Number: pfam03571 Score: 723 E_value: 6e-77
Swissprot: Q08225|DPP3_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0042802 = Molecular function: identical protein binding

Sequence:
>Contig1464
TTGGACTCCATGTATGATACCCCGCCTCTCGGCACCCCTCCTCTTATCAT
ACCCCATCGCCAAATCCATCGGGAACAGAAAACTCAATCGGACCGCCACC
ATGTCAGACGAGGCCTCAATAGCCCCTTCCCCCAATAAGCCGCCGGAGCC
GACATCCCCCCCCGCTGCACTCCTAGCAGACTCGCCCCCAACCATTTGCC
GGCTAGAAGTCGCCCCACACTTCGCAGCCTTAACCCCCAAAGAAAAGCTC
TACGCACACCACATCTCCCGCGCTTCTTTCCTAGGCACACGTGTGACCCT
CCGTCAACACTCGCCAGAAAGTGAGGCAATCTACGACCTCATACTCGCTC
TGTACGCCGCGTGCGCTGGGGACTGGAAAAAACTCGCTTCGGAGGGCCCT
GTCAGTGAGAAGGACGTGCAGTACTGGCTCGAGTACGCAACGGTATTCCT
CGCCTCGCTGGGGAACTACAAGTCCTTCGGGGACCTGAAGTTCGTGCCCC
GCATTCCGAAAGCAGAGTTACGTAAACTGGTGGAGTATGCTGATGAGGAG
GCGAGTAAGTTATTTTATGGAGTGGAGGAGGTTGTGTATTCGTTTTTGCC
AGAGGAGAGGAATTTAATTGGGTATATTGATGCTGGACATGTCTCGGCTT
ATTACCCCGACTCGCCAAGTATTTCGAAGGCGGAGATCGAAGAGGTGCAG
GCGGTCACAGCTGCGAATGGGATACTTGTCGAGAATACGAGGTTGAAGAA
GGTTTCCGACTCCGAGTTTCATTTACTGTTCGCTTCAGCGGAAGTGACGG
CGCCAGAGGGGCAGAAAACTGAATTTGTGTTTGGTGAGGGTAGGAAGAAG
TTGAAATTGGTGTACGGGGACCATGCAGAATTGATGAAGAAGATCTCCGC
AGAGTGTCGGGCTGCAGCGGAACGCTCCGCGAATGAGCTTCAGAGGAAGA
TGTGGGATGAATATGCCCGTTCGTTTGACATCGGGTCTATTCAAGCGCAC
AAGGAGTCTCAGAAGTACTGGGTGCAGGATAAGGGTCCCCGGGTAGAAGC
TAATATTGGCTTCGTCGAGACGTATCGCGATCCAGCTGGCGTTCGTGCAG
AATGGGAAGGTTTTGCGGCAATGGTGAACGAGGGACGGACGAGAACTTTT
GGAGAGCTAGTCAAGCGTGCGGAAGACTTTATCGCGAGGTTACCCTGGGG
CAAGGATTTTGAAAAGGACCACTTTTTGAAGCCTGACTTTACAAGTCTGG
AGGTTTTAACATTTGCTGGCGCAGGGATCCCGGCCGGCATCAACATCCCA
AACTACGACGACATCCGCCAGGAAATCGGCTTCAAAAACGTCTCACTTGG
CAACATTCTCTCCGCCCGATCCCCC

Sequences in the Contig:

SY0AAA18YH19FM1 SY0AAA30YB07FM1 SY0AAA50YO07FM1
SY0AAC21YE18FM1 SY0AAC27YD07FM1 SY0AAC29YH11FM1
SY0AAC36YB07FM1 SY0AAC36YK17FM1 SY0AAC3YI06FM1
SY0AAD55YN09FM1 SY0AAD55YN24FM1