Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1463
Length(NT) : 550
Best Gene Model Blast : Link to GSTUMT00011014001 E-value : 1e-155
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_08808
Accession: ref|XP_001226735.1| Score: 239 E_value: 7e-19
KEGG Definition: conserved hypothetical protein; K09659 dolichyl-phosphate mannosyltransferase polypeptide 3 [CAZy:GT2]
Accession: mgr:MGG_10055 Score: 237 E_value: 6e-19
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG4841 Score: 157 E_value: 7e-12
PFAM Definition: DPM3, Dolichol-phosphate mannosyltransferase subunit 3 (DPM3). This family corresponds to subunit 3 of dolichol-phosphate mannosyltransferase, an enzyme which generates mannosyl donors for glycosylphosphatidylinositols, N-glycan and protein O- and C-mannosylation. DPM3 is an integral membrane protein and plays a role in stabilising the dolichol-phosphate mannosyl transferase complex..
Pfam Number: pfam08285 Score: 288 E_value: 5e-27

Sequence:
>Contig1463
TTGGGACAATACCACGCTCATTACTATCGTACCACCCCCAACTACCTACC
ACTACAACAACAGCACCACTACTACTTACCGCCCATCAAAAAATGACTCG
TGCAACAGAAACCATTTCCATCGCACTGCTCCTCAGCTCCCTCTACCTAG
CAGCATACCTCCGCCTAATCCCCTTCCCGGACAAGATCCAAGAGGAGATT
ATCCCCGTCCTACCGTTCTGGGGACTCGTCTCGTTCGGTTCGTACCTGCT
TTTCTCGCTTGGGTGGGGTATTGTCACGTTTCGGGATACGGAGGAGTCGT
ATAAGGAGCTTGTGGTTGAGATTGAGACGGCGAAGAGGGAGTTAAGGGGC
AAAGGGGTTGATGTTGATTAAATTTTTGTTTCTCGCTATGTGAATGTGGG
GGAAGGGGTTGAAAAGTTGGTTCTTTTGTAGATCCGGCTATCGTGGTGGA
GTGGGGAGAGGAGGGCTGTTATTAATGAATGAGGGGTGGGGGGAGGAGGA
TGAAGTGGCGAGTTAAGGATATCTTGAATTGAAGTGCTCTATTGGCGTCT

Sequences in the Contig:

SY0AAA50YN18FM1 SY0AAD58YG11FM1