Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1462
Length(NT) : 1575
Best Gene Model Blast : Link to GSTUMT00011677001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: serine/threonine protein phosphatase 2B catalytic subunit
Accession: ref|XP_001558972.1| Score: 1674 E_value: 0.0
KEGG Definition: calmodulin-dependent protein phosphatase [EC:3.1.3.16]; K01090 protein phosphatase
Accession: mgr:MGG_07456 Score: 1628 E_value: 1e-179
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0375 Score: 1526 E_value: 1e-170
PFAM Definition: Metallophos, Calcineurin-like phosphoesterase. This family includes a diverse range of phosphoesterases, including protein phosphoserine phosphatases, nucleotidases, sphingomyelin phosphodiesterases and 2'-3' cAMP phosphodiesterases as well as nucleases such as bacterial SbcD or yeast MRE11. The most conserved regions in this superfamily centre around the metal chelating residues..
Pfam Number: pfam00149 Score: 239 E_value: 1e-20
Swissprot: Q05681|PP2B_NEUCR

Sequence:
>Contig1462
TTGGCACCTCGCTCAGTCGAATCCCTCAATTTACCTTTCTCATCAACAAA
CCCTCCCACCAAAGACGCTGCTACTGTACCTGTAGGGTACTTCACATCAC
ATTCCTCTCCGACAACACCCCCCGGGGCCCTGCCTCCCCCACCACCGCGC
TGGGTAGTCGTGTCCGCCTCTCTTCCTTGTGCGTGCGCTCCATCAACTTG
TCACCTCCCCTTCCACTTCCCCCCTCTAACCCCTTCTTTCTTCTCAAGAA
ATAAATAAAAAAAACAACTTCTATCCTCAACCCCTTCCCCCCTCAGTTAC
ACCCAATATTCACCGGAGCTTACTGTTGTCTCTTTCGCTTCAGAGACAAC
CCCGCTCATCCCACCCCTCACTCCCTATCCCACCGCCCCTCATTCCGCTG
CTCAACCTCGACGCAACAACTACTCTCGTCAACGGAAAGGGGAAAAAGAA
AACAATAATCAGACAGCGTCAGAAAAACGGCCTCTAGCTTGATTCTAATA
CTCCCTTCTTGCGATGGCCGATCCCAATGCATCAGCGGTGGCTATTGAGA
ACAGCAGAAAGCAGGAGAATGCCATTCGTGCTGTGATTGAGAAGAAGGCA
CCCCCGGAAATTGATTTCACTCTGCATACTATGGAAGATGGGACTCAAGT
TTCGACACTTGAGCGAGTTTGCAAGGATGTGCAGGCACCTGCATTCCACA
AGCCTACAAATGAGCAGTTTTACGACTCTAATGATCCTACAAAGCCGGAT
CTCGCATTCCTGAAGCAGCACTTTTACCGCGAGGGTCGTCTTACTGAAGA
GCAGGCCATCTTCATTATTAACCGTGGCACTGAAATTCTCAGGACCGAAC
CTAATCTCCTGGAGATGGACGCGCCGATCACTGTGTGCGGTGACGTTCAT
GGGCAATATTACGACTTGATGAAATTATTTGAAGTAGGCGGGAATCCCGA
GGAGACTAGATATCTGTTTCTGGGGGATTACGTTGATAGAGGGTACTTCA
GTATTGAGTGCGTTTTATATCTTTGGGCGCTGAAGATCTGGTATCCCAAT
ACTCTTTGGCTTTTGAGAGGCAATCATGAATGCAGGCATTTGACAGATTA
TTTTACCTTCAAGTTGGAATGCAAACACAAATATTCTGAACGTGTATATG
AAGCTTGTATGGACAGTTTTTGTGCGTTACCACTGGCAGCAGTTATGAAC
AAGCAGTTCTTGTGTATTCACGGTGGATTGAGTCCTGAGCTCCAGACCTT
GGATGATCTGCGAAGTATTGACCGTTTCCGCGAGCCCCCCACTCATGGTT
TGATGTGCGATATTCTTTGGGCCGACCCTCTAGAAGAGTTCGGACAAGAG
AGAACTTCTGATTTCTTCATCCACAATCATGTTCGTGGCTGCTCTTACTT
TTTTTCATACCCAGCTGCTTGCTCGTTTCTCGAAAAGAACAACCTGCTCT
CTGTCATCCGTGCGCATGAGGCACAGGACGCAGGGTACAGGATGTATAGG
AAGACCAAGACAACTGGATTCCCAAGCGTTATGACCATCTTTTCTGCGCC
CAATTATCTTGATGTGTACAACAAC

Sequences in the Contig:

SY0AAA31YF07FM1 SY0AAA50YN12FM1 SY0AAA58YD19FM1
SY0AAC21YN05FM1 SY0AAC37YL20FM1 SY0AAC52YM03FM1
SY0AAD12YE24FM1 SY0AAD22YG17FM1 SY0AAD24YJ05FM1