Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1461
Length(NT) : 904
Best Gene Model Blast : Link to GSTUMT00009354001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001249186.1| Score: 644 E_value: 2e-65
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1461
TTGGCACCCCAGCATCCCTTGAGCTCCGCAAAGCCCCATCTCATCCACCA
CGCCTATTCTAAGAGGTAACTAGCAGCATACGCCGCGGAAATTTCTCGAC
TTTTTTCCTACACCAGGTCTCAAGTCACTCCAACGGTTACATTTACGACA
ATTACCAATACCAACAATGTCTCTAAATCGCTCTCTCCCACGCAATGTCT
CATTTTATGACGCTACCAATCCTGAGGAGGTTCTTGGAGGGTTTGTTCAG
AATGGGTCTATAACTGAGGCAAACTTTCTTGACATTCTCGGGATCTTACT
TGTCGTTGGGGTGAGTCCGATACGTGTTCAAGAGAGGATGTCGAGCCACA
TCGTATCCAGAACGGAAGTGCCCCTTCAAGTGGGCGTATACGATATTTAT
TGTGAAGCCTCTATCCAAGTTAGTGATGAACCTTGGGTGCACCGGTTGAT
TTCTCATAAAATCACAAGCAGCGAGGATAGTTTCCATAATGATATCCGTA
ACCGCGACCGGAAATGTGTTATTTCGGGAATTTCTGTTCCTGAAATCCAT
ATCCAGTCCAATAACTGGACCACTTTTGAGGCTGTCCATATATTCCCTCC
CGAGCGCTCAAGTCTTTGGATTCAGTATGACTATGGACGGTGGATCGCAG
GCAAGGACGGCACTACCGAATCCTCAAAGATCAACTCACCTCGAAACGGG
CTTCTTCTTGGGTTAAATATCCAGCAAATGTTCGATCAGTACCTCATCTC
CGTTAACCCGGACGACGGTTACAAGGTAGTTGTGTTTGACTCTGATATTT
TTGGCTACGACGGTAAAACTCTTGATCCCGTGTGCCGAAACCCGGCCGAT
CCCCACTCTGTGTCTGATGAGCTTCTAAGATGGCATTTCCGCCAATCAGT
CCTC

Sequences in the Contig:

SY0AAA50YN09FM1 SY0AAB20YL07FM1 SY0AAD32YE10FM1
SY0AAD56YJ05FM1