Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1460
Length(NT) : 1899
Best Gene Model Blast : Link to GSTUMT00009009001 E-value : 0.0
Numbers of ESTs : 27

Blast Results:

Nr Definition: hypothetical protein CIMG_05862
Accession: ref|XP_001241966.1| Score: 1462 E_value: 1e-160
KEGG Definition: ubiquitin-specific protease [EC:3.1.2.15]; K01072 ubiquitin thiolesterase
Accession: aor:AO090120000125 Score: 1454 E_value: 1e-159
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1872 Score: 1022 E_value: 1e-111
PFAM Definition: UCH, Ubiquitin carboxyl-terminal hydrolase..
Pfam Number: pfam00443 Score: 377 E_value: 1e-36
Swissprot: Q92353|UBP6_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>Contig1460
TTGGCCCTCTTGTCCATCCCGAACCCTAGATCTTCTTCAACACATCCTCC
ACTCCACTCTTGTCTTCAAATAGAGTCACGCACCCGCTTTCACCCCATCG
GCTCTATCAAACCCCGTCGGTTAATCCTCACGGGCGCGAGATGAGTTCCA
TTACAGTCTTCGTTAAACATGCCGGAAAACGTCACGAGCTCGAATTAGAC
CTCTCCCAGTCTGCCGAAGTTTTTAAATATCAACTCTACTCTCTTACCCA
AGTCGAACCTGAGCGCCAAAAGATCCTTATCAAGGGTGGGCAACTTAAAG
ATGACACAGACCTCTCTGCTCTGGGTATCAAACCCGGACATAATTTCACG
ATGATGGGAACCCCTGCCGGGAAGAGTGTGCAACCACCAAAAGAGAAGAT
GAAGTTTCTGGAAGATATGAGTGATGCCGATCTCGCTAAAGCCGCAGGTG
CCATACCTTCTGGGCTCCAAAACTTGGGGAACACCTGCTATATGAACTCC
ACCCTCCAGACTCTACGAGCTGTCCCAGAGTTACAAGAGGAGCTTCGGAA
GTATCAGGAAACCCCTGATAGTGCTGGTGGAAGCATTCTTGGTGGCTCAA
GCTCACTGTTGGCTGGGATCGGTGCTATCGGAGGTGATTTGACAAGCGCT
TTGAGGGACCTTTACAAACAAATGGGAGAAACCACCGGAGGATTCCCACC
AATGATGTTTCTTGGGGCACTTCGCACGGCATTCCCACAATTTGCGCAGA
AGGGAAAGGATGGTCATTATGCACAACAAGATGCGGAAGAATGCTACTCT
CAGATCATCTCACAATTGAAACAAAAACTAAAAATCAACCCAGGAGGAGA
GGGTTCTTCGACTTCCGTTTCTTTTATCGATAAGTACCTGTCTGGTCAAA
TGGTGTCGACGCTGAAATGCGATGAGGAAACCCCGGATGAGCCACCCGTG
GAGGTCGTCGAAACTTTTCTCAACCTTAAGTGCCATATTTCCTCTTCAAT
CAGTCATCTTCGTGATGGATTACTGTCTGGCTTGACTGAGGCGATCGACA
AGCACAGTCCAAGCTTGGATAGAGATGCTTCGTATACAAAGACCAGTCGC
ATCACTAGGCTTCCTAGATACCTTACTTGCCATTTTGTTCGCTTTTATTG
GAAGCGCGAGATCAACAAAAAGGCCAAGATCATGCGCAAAGTGACATTTC
CTTTCGAACTCGATGCGACCGAGTTTTGCACGGATGAGCTCCGTCAGAAG
CTTATCCCTGTCCGTGATCGCCTCCGGGATCTCCGCAAAGACGCCCAGGA
TCGTGAACGTACCCGCAAGCGCCTCAAGCGGTCTGCCGCCAACCCTGATG
ATGTTGCCGGCGGAAACGCTGGTGCGAGCGGATTTGGCGCGGCTCAGAGC
CAGCAGGCGGCACAAGCTGAGGAGAAGGAGAAAAGTGAGGCCGAGGCAAG
GCTTAAGGAAGCAGAAGACAATCTCCCTGACTGGGAGCAAGAGCTAAAGG
ATAAACTTGACCCTGGTCTTGCCCAAGACGAGGGGTGCAACGCGAGTGGC
CTGTACGAGCTGATGGGTGTCATAACCCATCAGGGTTCGAGCGCAGACTC
CGGTCATTATTGCAGCTACGTCAAGAAGGAGGGCGATGACGATTTGTGGT
GGTTCTTTAATGACGAGAAGGTCTCGGAGGTGCCTAGAGATAGAATTGAA
ACCCTGGCCGGTGGTGGGGAGAGCCATTCTGCCTTGATTTTGTTGTACCG
CGCCGTGCCCCTTTCTCCTCCCCTCTCGGAAGTCAGAAAGTGAGATTCTG
CTGGAGGTGAACTGTGTTACTTGCTTTTCTCTAGACGCCACGGAATTAGC
CTGGGATGGAGTTATCTGTATTAGCATGGGAATTAGAGCAGATCAAAGC

Sequences in the Contig:

SY0AAA34YO20FM1 SY0AAA35YP09FM1 SY0AAA36YB02FM1
SY0AAA4YJ17FM1 SY0AAA50YM15FM1 SY0AAA52YE07FM1
SY0AAB33YO17FM1 SY0AAB49YA08FM1 SY0AAB51YL15FM1
SY0AAB57YI11FM1 SY0AAC12YL22FM1 SY0AAC18YM15FM1
SY0AAC27YJ17FM1 SY0AAC27YJ17RM1 SY0AAC31YH13FM1
SY0AAC32YL24FM1 SY0AAC33YM24FM1 SY0AAC35YO08FM1
SY0AAC46YJ13FM1 SY0AAC48YC03FM1 SY0AAC48YO04FM1
SY0AAC56YN04FM1 SY0AAC5YA19FM1 SY0AAC61YD10FM1
SY0AAD34YD18FM1 SY0AAD51YC16FM1 SY0AAD62YK18FM1