Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1459
Length(NT) : 866
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1459
TTGGCCAATCTTCACTTTCAACATCTCGTCTCTGTTTGCCATTACTTGCC
CCTACCGGTATTCATAAATATCCTCCTGTTCTCCAGTAAGCAAACCTATC
CCTTCCGAATATGAAGCACCTGACCACTACCGAGAGCTTTAAATACGACC
CACTATCCAGAGGATTTGCCTCCGGGGGGGCATGTTTCATAGTGGGTAGT
TATCCCAGTTGGTGGTCTTTATCGTCATATCGGTAGGGGTGATGGCTGAT
TCGGGTTGGGAGGTTGTGGCATGCGTCAAGAGAACCCGGATTCGCAAGTC
GGGCTTACTTGCCGCTATCTCCCATCATAAACCTCTAATCTCTGGCGCCA
TTAACTTCTTGAGAAATTCTGATTGCTCGGTATCAGCTGAGTTCATCACG
ATGTGAGCATCTCTCTAGGGTCCACGGGGCCCTTGGCGTCGTTTGGCACC
GCTGGGAGACGAGAGGGTGTTTTGCAACTATTCTCTCAAACACGTTGTCT
GATATGACAGGAGGGAATAGTGCCAAAGCTCTTCGGGTGTACTCCTTTTA
GGATCCTGATGCCATACCAATGTAAGTTAGGGCATCGACGTGTACTATAT
CCCTCCAGTGGCAGGATCAGACAGGTCCTGCTCGAGTACTTGCGCCTGGG
AACCATAGAATCGACTCTCATTCCCAGAGCCCAGAGAAGGCCCTCAGCCT
CCTAGCGTTTCACCTCTTCCGCCCACCGAATATAGCTTTGGGGGAATCCA
TAAAGATAGCGTTTAGGACCGTAGTCCCCATTTTCTTTCCAAACTATCTA
CTATCTTAGGGGACGGCGAGGACCCTCATCGGCAAGCACACCGCGCCTGT
GGTAAAAAGGAGCTCT

Sequences in the Contig:

SY0AAA50YM07FM1 SY0AAC19YN24FM1 SY0AAD45YM24FM1