Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1458
Length(NT) : 809
Best Gene Model Blast : Link to GSTUMT00005179001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein MGG_08834
Accession: ref|XP_363989.1| Score: 363 E_value: 7e-33
KEGG Definition: hypothetical protein; K02903 large subunit ribosomal protein L28e
Accession: mgr:MGG_08834 Score: 363 E_value: 3e-33
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3412 Score: 305 E_value: 1e-28
PFAM Definition: Ribosomal_L28e, Ribosomal L28e protein family..
Pfam Number: pfam01778 Score: 327 E_value: 2e-31
Swissprot: O14069|RL28E_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1458
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGCCTAACCGACGAATATCT
AGAACCCCCGGGTAGGCTCTTGACACCCTTTTTTCTTTTTCCCCCAATAG
CTTCGCATCTTTGTGCTGTAATTTTTGGTTCCGACAATTTTCCCACTCGC
AACCTCATCCTCAATTATGTCCTCAAATGTCAGCTCCGATCTCATCTGGG
CCATCACCAGGAATAATTCGTCTTATATTGTCAAGCGTGGACCTGTCAAA
GACCAGATAATCTTCACCAGGGAGCCTCTGAGTCTCACTAACCAGCACAC
ACGCAAGCACTCTGGACTTGTGAACGAGAAGGCCGTTGGTGTTCAAGCTG
GAGAGAATGGAAATGTTGTTTTAATTACGAAGAAGAATGCTGAGAAGCAT
GGAGACAAGCCCGCCTCCCTATACAACAAGACTACCTTCCGCAAGTACAA
GAGCAACCGCAAGATCTACTCTGCTATTGCCAATGCCGTTGCCAAGAAGT
CTTACCGATCTGACCTTCGCCAGGCCGCTGTTGCCCGTGCTAGCGCCATC
AAGAGATCGCAGAGACCCGTTAAGGCTGCTCCGGAATCTAAGCCCAGGGG
CGTTAAGGCCAAGAAGGCAGCGGAGGAGAGGGCTTCGTAAGCTTAGGCTT
TGAGCTACGGTTCGGAGGAGAGAGTCGAAGGTGGGATTTTACGAACTAAT
GGACCCGTAAATAAACCGGAATATTTCAAAAATAAAAAATTTTCCGTCCA
CCATTCGAGCCGGTTAGATCTCGTGCTCGAATACGTGATCTTGAGATCCG
TGGTGGGGT

Sequences in the Contig:

SY0AAA3YH09FM1 SY0AAA50YL19FM1 SY0AAB1YI10FM1
SY0AAD46YL01FM1 SY0AAD52YN23FM1