Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1457
Length(NT) : 1141
Best Gene Model Blast : Link to GSTUMT00004653001 E-value : 0.0
Numbers of ESTs : 40

Blast Results:

Nr Definition: hypothetical protein CIMG_10080
Accession: ref|XP_001239058.1| Score: 351 E_value: 3e-31
KEGG Definition: hypothetical protein
Accession: yli:YALI0E00594g Score: 339 E_value: 3e-30
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0860 Score: 350 E_value: 8e-34
PFAM Definition: Synaptobrevin, Synaptobrevin..
Pfam Number: pfam00957 Score: 255 E_value: 1e-22
Swissprot: Q92356|SYB1_SCHPO
Gene Ontology:
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0030659 = Cellular component: cytoplasmic vesicle membrane
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0005794 = Cellular component: Golgi apparatus
GO:0031097 = Cellular component: medial ring
GO:0000910 = Biological process: cytokinesis
GO:0006897 = Biological process: endocytosis
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0009826 = Biological process: unidimensional cell growth

Sequence:
>Contig1457
TTGGGTACTTTTCATCGCCCCTTAATTCTATGGGAATACTGGTATCCCTT
TATACATATTGATTTGGTTTGGCCACGCTGCCTGCGTTGCCACCCAAGTT
CACATACAAGTATCATACATTTCTCAAACATACCCTACCCTACCGCAGCT
CCGGTTGCCTCCTCGCCCAATCTCCCGCCCTTGTTTGCGACCGAGCAAGT
CAACCATCCCTCTCATCATCAGCACCACCCTTCCCATCCATCCATCTCCA
TCAACCCTATCCCCCATCCAAACTACACCTAACAACTACAACTGCAACTA
CAATCTCCCCGTTCACGAGTCTGCTTTTTTCACGTCGCTCGCCCTTAACG
AATCCTTTTCACTCTAACCAAGCTCACCTCTCGCAAAACTCATAATGTCT
GACCAGCCGTACGATCCTTACATTCCCAGCGGTGGTGCTGGCGGTAGTCA
AGGACAGCCTGGAGGTCCTGGAAACCAGAGGACTGCAGCTATTCAAGCGC
AAATCGACGATACCGTCGGAATCATGCGGGAGAACATCAATAAGGTCGCC
GACCGTGGCGCCAGATTGGACAGTCTCCAAGATAAGACTGACAATCTTGC
TGTGTCTGCGTTGGGTTTCCGCCGCGGGGCTAACAGGGTCCGAAAGCAAA
TGTGGTGGAAGGACATGAAGATGCGCATGTGCATAGTTGTTGGTATCATC
ATTCTTTTGGTTATTGTCATCGTCCCAGTCGTTATCAGTCAAACTAAATA
ATCGAGTTGTATGGGAGAGGTTGTTTGGTTTTTTCTGGCGCGGGAGCGGT
TTTCATAGACAGGAGAAGAGGGCAGCTCGGCTTTACGGTGGTCAAGGGGT
CCTGGTTTGGGGCGGTGGGAATCATGTCTGACGACAATCCGACAATGAAT
GGGCATGAGAATCACGACGAGAAACTTTCACATGAAAACAAAACAAAAGT
AAGCAAGCAGAAAATATTCCAATTCTCAATATGACTTTTTGGGTTTTGGA
ATTGGGTCAATGGGATGCTTGGCTGTCTTTAGGTTGTGGGGACCGGCGAA
ATTCTTGTTTTCTTTCCTCCTTTTCTTTGCTTTTCTTTTCTCTTTACTGT
GTATCTGCTGGAATTCCCTTTGTGCTGTTAGTTTTGATGGA

Sequences in the Contig:

SY0AAA15YM18FM1 SY0AAA33YP05FM1 SY0AAA34YM20FM1
SY0AAA37YB13FM1 SY0AAA39YJ19FM1 SY0AAA41YB09FM1
SY0AAA41YF23FM1 SY0AAA41YI18FM1 SY0AAA46YD16FM1
SY0AAA50YK21FM1 SY0AAA6YA08FM1 SY0AAA6YL19FM1
SY0AAA9YO22FM1 SY0AAB10YE10FM1 SY0AAB11YM22FM1
SY0AAB12YM22FM1 SY0AAB1YP15FM1 SY0AAB21YM01FM1
SY0AAB27YM19FM1 SY0AAB2YL08FM1 SY0AAB32YM08FM1
SY0AAB32YP22FM1 SY0AAB37YG24FM1 SY0AAB37YM11FM1
SY0AAB41YE18FM1 SY0AAB43YF16FM1 SY0AAB48YG16FM1
SY0AAB4YB05FM1 SY0AAB51YD09FM1 SY0AAB55YE09FM1
SY0AAB56YO05FM1 SY0AAB59YM18FM1 SY0AAC27YL07FM1
SY0AAC40YP02FM1 SY0AAC43YC07FM1 SY0AAC57YH03FM1
SY0AAD19YA16FM1 SY0AAD1YO09FM1 SY0AAD51YD11FM1
SY0AAD63YP09FM1