Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1456
Length(NT) : 576
Best Gene Model Blast : Link to GSTUMT00011859001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: AP-3 adaptor complex subunit mu, putative
Accession: ref|XP_001266700.1| Score: 411 E_value: 9e-39
KEGG Definition: AP-3 adaptor complex subunit mu, putative
Accession: afm:AFUA_4G13490 Score: 398 E_value: 1e-37
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2740 Score: 292 E_value: 2e-27
PFAM Definition: No Hit Found
Swissprot: P47795|AP1M_DISOM

Sequence:
>Contig1456
TTGGATTCGTCTGTAAATTAGCTTTGATACCGACTACCACCTTCGCAAAG
ACATGAGTGCCGTCGAAGCTTTGTACGTCTTTGACAGCTTTTCCCCGGCT
ACAACACCAATCCTACAACATGAATGGAGATCACGACCAGCTACTAATGC
TGCCTCCCTCTACTCGCTCTACAAAGCTCAACCGTCCCCACGTCCCTCAT
TAATATATCTGCCAACGACCTCACCCCCTATTCTGCTTTTCAACATAATA
CATAATAACCTCTTGTTTCTTTCGCCCGCAACGTCCGAGATAGAACCGTT
GCTAGTATCGGAGTTCTTGCATCGGGTGGTTAATGTTCTCGAAGACTACC
TGGGATCCCCATTGCTGGGGAGCAAAATTGAGGCAAACTATGACATAGTT
GCTCAGTTGCTGAACGAGATGTGTGATGACGGGTTCCCATTCACGACGGA
ACCGAATGCATTGAGGGACGTGGTACTGCCGCCCAGTTTAATGGGCAAGC
TCTTAGGAAGCGTCACTGGTCTACCAAGCGCCTCTATCCCTTCATCTTTT
ACTCCCTCACCAACTAGAACTCTATC

Sequences in the Contig:

SY0AAA50YK07FM1 SY0AAB2YK14FM1