Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1455
Length(NT) : 1169
Best Gene Model Blast : Link to GSTUMT00008317001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 413 E_value: 2e-38
KEGG Definition: hypothetical protein
Accession: ang:An11g03610 Score: 370 E_value: 9e-34
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig1455
TTGGTGGATATTTGAGAAATCTACTCGAATCCTCCGCCGATCGGACATTC
CTCTGGGTTTCTCTTGTTCTCGAGGTTTTGAAGGATAGTGTGGACCAGTC
GCGGGAGGTGCTTAGCGGCATTGTCTCCAATGCTCCGCGCGATCTACCGG
AACTATATACCAAGATCCTGGATAAAAACACAGAGCCCGACACAGCACGA
CGAATCCTACATATAGTGGTAGCAGCAGCAAGGCCTCTAACACTCCAGGA
AATGCATATCGCATTCAAAATTAGGCCAGACCACAAAACAAGCAAGGACA
TCGGGGATCTTCCGGGTGGATTTGATAGGACAGTGAAAAATTTGTGCGGG
TTTTTCGTGCGAGTTGTTGATTCGAAGGTCCACCTCGTTCACCAGACCGC
GAGGGAGTTCTTGATTAAGGGACGATTATCGGGTCAAGGAAACTGGCAGT
ACACCCTGTGTTCCGAAGAGTCTAACTTTATATTGGCTAACATATGCATC
TCATATCTATTACTGGACGACTTTGAAACCGACCCATTAGCGATAAATTC
TCCATATAGGGGGAGAGACTCTGAATATGCTGCTTATGTACGGAAACATG
GCTTTCTGGATTACGCCGCGAGCAATTGGGCAGGCCATTTCCGGGAATCG
GGGACGCAGCAGATGGAGTTATTCGAGATCACGCGGCAGATTTGTAAAGG
TGGATCAAGAAGATTTCTGACCTGGCTTAAGGTGTACTGGGGAACAAACC
GACGGTATCGTCCATTTCCTAGTGGTTTTACGCATTTGATGAGCGCCACG
TGGCTAGGGCAGCAGACAGTAGTTGAGCGATTATTGGATGACGGCGGGGA
TATGAATGCTCGATCCAAACAATACGGCACGGCAGTGAACGTAGCAGCAC
TCCAGAAAGATGAGATTATAACCAGAATGGCTGGTTGAGAGGAACATCAA
AGCCTATATACGGGGGAAAGAGTACAACATCTTGCAGACGAAGAGAAGCG
AGCTTGAGGAGATTATTAATCCGCTCCCGGAGTGCTGTAGCGAGGTCTTT
TGCTTCGAGGTGGTTCGGGTGAGGGAGTACGTGGACATGACCGGTCCCAG
TTCTGTGGCTGGGCAATTACTAATATCTAAGCTCTCTGAGTGCTGTAGTG
GGCGTTTCCGTTGTTTCGG

Sequences in the Contig:

SY0AAA25YB23FM1 SY0AAA50YJ18FM1 SY0AAA55YK10FM1
SY0AAA59YD13FM1 SY0AAB34YK11FM1